Open Close
General Information
Symbol
Dmel\fal-RB
Species
D. melanogaster
Annotation Symbol
CG9670-RB
FlyBase ID
FBtr0290284
Feature type
Associated gene
Evidence Rank
Length (nt)
1925
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 71 )
Sequence
TTTACAGTTGTGTACGTTCTGCTTGACGAATCGGAGTCGCTATAAAATGTAAAAAAATACCCGGATGTTATATATTCGCA
CAAATCGGCGGGAAGACAGCCTTCAAGACGTCGTGCTGTGCGCATTTTCGGGTTTGCTTCGGACGCGGATTGTCGATAAG
CAGGAATCCAATTAGAATGTCAGCCAGCGCAGTGATTCACTCCCTCGCTCAGCGACGGCGCTCTCTTTCTCTTCCCCTCT
CCAACGAACCAAAGAACTCGAAACTCCCGCTTTCCCAACAACAACTACAACAGCAGCAGCATGGACACCACGAACAACAA
CAACGCCCATCTATGCTTATTGAGGATGAGGTTCACGGTGTAATCGAACTGTCGAGCCATATCCAAGAGATCGTCGAGCA
TCCACTCTTCCAGCGCCTCAAACATGTCCACCAGTTGGGTCTCCTTCCGTGGGCCATCGATAAGAAGGCCGATCACAAGC
GATACGATCATTGCCTTGGAGCCTACAAAAGCGCGCAGGATCACCTTAGGGCCATCGAACGTAATTCGCATTACGAGCCA
AAGCTTCCGGATTGGTGTCGTCAGGCGGTGGAGATAGCCGCTCTCCTTCACGACATTGGTCACGGACCAATGTCACATGC
CTGGGAGTTGGTGACCCACCATGAATTTGATCACGAGGAAAACGCAATGGCCTGTGTGGATAAAATTTTTAAGGATGCCC
TCAATCAGGAGCTAGTCTCCTTGAGAGATGATGGTGGCGGGCGAGGTGTTCAATTGATAAAGGCTTTGATATTGGGATCC
AGTGAGAATCTGCCGTTCCCCATGCTGGGACATACCTACATCTTTGATATTGTGCATAATCGTCGCTGCGGATTGGATGT
GGATAAATGGGATTATCTGCGGCGTGATAACAAGCGCCTGAAAATACTCAGCTCTGCGGAAATGGACTTTGATGATGTAT
TTCTTCAGGCTCGCATATCACCTGATGGTCAACGCATAGAGTATCGTTATGCTGACTATCATCGGGTATATCGCTTGTTC
GAGGCGCGATCGCTGCTCCACGTAAAGGCCTATCAATATCCGCTAACTTGTGCCATGGATGTTATTTTTGTCAGTGTAGT
ACAACGTATTGCTCCAGAACTACTAAGTATTCGCTCAAAGGATCCAAAGTGGCTGGAATTGACCGACGAGTATGTTTTAA
ATGTCATTGAAAAGGATCCTATATCGAGATATGTAAAAGAACCTCATCGACTCGTAGAAGTCCCCAGCAACGACTGTTCC
GGATCGGACATCATACGGGTGAACAGGGTCATACCTGGACCTTGGGAGCTTATAAAATCCGCAAGGGAGTTAGCTTTCTT
TGGCAATAAGCGCAAGAAGCGTCCAATTACCCGATGTGTAAGCCCGACGATAGTCAACAAGTGCTTTAAGTTAGAGTAGA
AACATCCACCAGAGAATAGTTCATGTTAAGTCAACAAACAAACGTATGTTATTGTTTCCATTCGCTTCGTTTTCTTATAT
TTAATAAACTATATTTCATAAAAAGATGTACAAATACTCCAACGGTTGCGTTCGTAGTGCGGCCATTCTTATTGCCATTT
ACATTTTGTTATCCAGCATAGTCGTTGAGTTTTTTTTAGTTATTTAATGTTCTTTATTTTTATTTTTCGTTTCCATTTAT
AGTTAAAACTGTGAAATCAGTGGAAAGACAATATGTTCTTAAAATATTCATTTATTAGTTTATACAGTGTTTATCATAAT
CGACTTAAAACTAAAATACTAAACCAAAAATTTCAACAGTTCACTTGAAGACATCACAATTCAAACTCAGGTCTTTATAA
CATAAGGTACTTACTAATCTATATAAATATAAGATGCATTTGTCATATTTTTGATAACCGCTTTGAAATATACACAAGAG
AAAAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0321324
2519
FBtr0347258
2128
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0288723
368
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0302865
368
FBpp0312519
368
Comments

Transcript terminates at site supported by polyadenylated cDNA.

Downstream translation start supported bycomparative analysis across Drosophila species.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
fal-RB
Secondary FlyBase IDs
    References (0)