Open Close
General Information
Symbol
Dmel\mEFTu1-RB
Species
D. melanogaster
Annotation Symbol
CG6050-RB
FlyBase ID
FBtr0301389
Feature type
Associated gene
Evidence Rank
Length (nt)
1776
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 32 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CGCACAGCACATTTCAGGGTTTACGCAATTTCGAGCCGTAAGATTTTCTTCGACCTGTGAAAAGGCTTTTTACCCCCTGC
        CAGGATAGCTAAATCTTCACTCGTAAGTGCAGCAGGAGCTATCCATCGCGTAGCTCATATTCTAATCCACACATTTAGTT
        AAAAGCGCCAATAGGAAGCCCAGAACCATGTCACATGCATTTGCCGCCGCCGTCTGCCGGTCCACCGCATCCATGTCATT
        GGCCCTGCGCTGCAGCCGGCGCGCCATGAGCTCTGCCAGAATGCTGCGTATGGCGGGTGCCACTGCCACCTCCACGGCCT
        GCAAGGATTGGCAGAGAAACGGACTACTTGCTGCGCCCAGAACCGGCAACATGCAGCAGTACCTGCGCGAGTACGCCAAC
        GAGAAGAAGGTGTTCGAGCGAACCAAGCCCCATTGCAATGTGGGCACCATTGGCCATGTGGATCACGGCAAGACCACGCT
        CACGGCGGCCATTACCAAGGTCCTGGCCGACAAGCAGCTGGCCGAGAGCAAGAAGTACAATGAAATCGACAATGCGCCCG
        AGGAGAAGGCTCGTGGTATTACCATCAATGTAGCCCACGTGGAGTACCAGACGGAGACGCGTCACTACGGCCACACAGAT
        TGTCCGGGACATGCCGATTATATTAAGAACATGATCACCGGCACAGCCCAGATGGATGGCGCCATTCTCGTTGTGGCCGC
        CACCGATGGCGCCATGCCCCAAACTCGCGAGCATATGCTGCTAGCCAAGCAGATCGGCATTGATCACATCGTGGTGTTCA
        TCAACAAGGTGGACGCCGCCGATGAGGAGATGGTCGACCTGGTGGAGATGGAGATCCGAGAGCTGCTTACCGAGATGGGC
        TATGATGGTGACAAGATCCCTGTGGTAAAGGGCTCGGCGCTGTGCGCCCTCGAGGACAAGAGTCCCGAGATCGGCAAGGA
        GGCGATCCTGAAACTGCTCCAGGAGGTGGATAGCTTCATCCCCACGCCTGTGCGCGAGCTGGACAAGCCCTTCCTGCTGC
        CTGTTGAGAATGTGTATTCGATTCCCGGACGCGGCACCGTCGTCACTGGTCGCCTGGAGCGCGGAGTGGTCAAGAAGGGC
        ATGGAGTGCGAGTTCGTGGGCTATAACAAGGTGCTGAAGTCGACGGTGACGGGCGTGGAGATGTTCCACCAGATTCTGGA
        GGAGGCGCAAGCCGGTGATCAGCTGGGAGCTCTGGTGCGCGGCGTTAAGCGAGATGACATCAAGCGCGGCATGGTCATGT
        GCAAGCCGGGCAGTGTGAAGGCACTCGATCAGCTGGAGGCCCAGGTGTACATCCTGTCCAAGGATGAAGGCGGTCGCACA
        AAGCCCTTCATGTCCTTCATCCAACTGCAGATGTTCTCCCGCACCTGGGACTGTGCCGTGCAGGTGCAGATTCCCGATAA
        GGAGATGGTCATGCCCGGCGAAGACACCAAGCTCATTCTGCGCCTCATCCGGCCAATGGTCCTGGAGCAGGGACAACGCT
        TCACGCTGCGTGACGGAAACCTGACCCTGGGCACTGGTGTCGTCACCAGCACTCTGCCCCCATTGACTGAATCGCAGCGA
        TCCGAGTTGACGGAGGGCAAGAAGGCGCGCGAGAAGAAGGTGGCGGCTAAGAAGTAGATCCCCGGAACGCCGTCAGTCAT
        TAACTAAAATCATATTCTTAAGCGATTTTTATGCATATTGTATAAGTTGTTGGCGCTCCAATCACAATCGAGTAAAATAT
        AAACAAACACCTATGG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0087670
        1720
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0290603
        489
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0086790
        489
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        EfTuM-RB
        mEFTu1-RB
        Secondary FlyBase IDs
          References (0)