Open Close
General Information
Symbol
Dmel\Fak-RG
Species
D. melanogaster
Annotation Symbol
CG10023-RG
FlyBase ID
FBtr0301883
Feature type
Associated gene
Evidence Rank
Length (nt)
4142
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 24 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TATCAGCAGAAGGATTCGGTCACACTGGCTACTACGGAGAAATAAGTTGAAACCTCTATACGGAATCGCCCACTGTGCGG
        TAACTGTGGACCATGAACACCGCGGGAGCCACCAGTCAACCGCCGCCCACTAAAAATGAGATTAACTCCGAGGAGTATCT
        CATCCACGTGCATATGCCGAACAAGAGCTTCAAGGCTGTTCGGTTTAATGTCAAGGAGACCGTTTTCCATGTGATCCGGC
        GCACTGTCGAGGATCTGGGCACGGATGGACGGACGCCCAGCATTCAGCGATATGCCTGCCGCATGCTTAACATGATCACC
        AAGGAGGTGATTTGGCTGGCTAGAAGCACTTCAATGCAGAAGGTTCTCTCGCACATCCTGACGCCCGGCTGCTCCAACGT
        TGACTGTCCCAACAACCAGTCGGAGTTGGATGAGGTTCTATTGGAGCACGGAAGAAGGATCACCGATAATAGGGTGTGGC
        GAGTGGAGCTCAGAGTGCGCTACGTGCCAAATAATATTCAAGAGCTCTTCGAGGAGGACAAGGCCACATGCTTCTATTAT
        TTCAATCAGGTGAAAGAGGACTTTATCCAAGCCAATGTCACAGCCATCGACACTGAAGTGGCGGTGCAACTGTGCTGTCT
        GGGCATTCGTCATTATTTCAAGAACATCACCGTGAAAGCACCTGACAAAAAGCAGCACATTGACTACATTGAAAAGGAAA
        TCGGATTTAAAAGTTTTCTTCCACAATCTGTGATAGCCACATCAAAGCCAAAGAATCTTAAGAAACTGATCCAAGTCGGT
        TACAAAAAGGTCTACAATTACAACGACATTGAGTACTTGACGCGGTTCTTTGATCTTCTGAAGAATATTTATTTAACGAA
        CTTCGAGCAGTTCTCGGTAACCCTGAGCTCGGCGTGGAATATTTCTGGAATTCTACACGTCGGCCCTCACATTGGAATCT
        CGTACCAGACTCATCCTCAGGCCAGCTTGAAGAACGTGGCTCAGTTTAAAGATGTGGTCTCTATTAAAACGTGCACTTTA
        CCAAAGGAAAAACTGTCCAAGTCTGGGGAGAATACCACAGAACCAGAGCTTCAGAATTTTAATTGCAACTGCCAGAAGAT
        TAAAACCCAAATAAAAATATCCGCTTCCAACAATGTGGAAGATTTGGTTATAACGTGCAATGGTATTAATACCGCTGAGA
        GTATTGCTGACCTAATTGACGGTTACTGCCGGCTGTTATCAAAAGACCTAGAGTTCACGATTTGGCATCGAGAGACAAAC
        GCGTCGAACGAAGATAGCGCAAAAGCATTGCCCAATGATGCGACGCTGGGGTCCAATAAATCAACTTCAAGTCAGGGAAA
        ACCGATGCTGACCGATGATTATGCCGAGATTGGTTTATTGGAGGGCGAGGGCGACTACTCTACGCCCACCGTTCGAAATT
        ATGAGTTGGACAGAGCCCTCATAACGCCGAGCGCCAAAATTGGTGTGGGACAGTTTGGTGATGTGTATGTAGGCACGTAT
        ACGCTTCCGAAACTGGGCAAGGGCAAGAACTTAGCAGGAAATGGAAAAAATAGTAATAGTGACCAAAGAAATGCCGATTC
        AAGGCCAGATGTTATACAAGTGGCGATAAAGACATGTAAAGCTAACGACGATCCTGAAAAAACCGAAAATTTTCTTGCCG
        AAGCTTATATTATGCAAAAATTCGATCATCCCCATATTATACGCTTAATCGGCATTTGCAGCGTAATGCCCATTTGGATA
        GTTATGGAATTGGCCAAACTGGGTGAATTGCGTGCGTACTTAAAGACAAACAGCGAAAGATTAAGCCACGGTACTTTACT
        GAAGTATTGCTATCAGCTATCGACTGCTCTTAGTTATTTGGAATCCAAAAAGTTTGTTCACCGAGATATAGCGGCGCGTA
        ATGTACTAGTCAGCTCACCAACGTGTGTTAAGTTGGCTGATTTTGGATTATCACGTTGGGTTTCCGATCAGTCGTATTAT
        CACTCAACACCCACAGTTGCCCTACCCATTAAATGGATGTCCCCCGAGTCAATAAACTTTAGAAGATTTACCACTGCTAG
        TGATGTTTGGATGTTTGGTGTCTGCATTTGGGAAATACTCATGCTCGGTGTAAAGCCTTTCCAAGGCGTCAAGAACAGCG
        ATGTTATATTGAAGCTCGAAAACGGAGAGCGTCTGCCATTGCCTCCCAACTGCCCACCTAGGTTATATTCGTTAATGTCC
        CAATGCTGGGCGTACGAGCCACTTAAACGACCGAATTTCAAGCGGATCAAGGAAACTCTGCATGAAATTCTGATTGAAGA
        CAGCATTAATTCATCGGAGACACTGAAGCGGGAGCAACGAAAAGTGGCTTCCATGTCCTGGATTGGCAGTGATGACATCG
        ACATTCCGCCATCGAAACCTTCAAGGGTGATGCACGATCCTGACATCACTGGCTTAATGCCTGAAACAACGGGGCTACCT
        CAGACCTATATTATTGCACAAAATCCCGCGGTGCTGGCCAAACTGATGATGGAGAACCAAAAACGAGGCATAAATCCAGC
        GGCGTACACCACACCAGCTTCGGGCATTCACAATGTTTTGGGCGAAAAACTACGACAACAGCAAAAGGATAGCAACAGCG
        ACAGCGAATGGTTAATTCAAGAAGAATTGCTACGGCAGAGATCCTGCTCAATACCTCAAGGATCGCTCAATGATCATCAG
        GCTCAAATGTTTAAGCTTGACTTCATGTCAGCTGGTCCTTCCAGTTTGCCGGACTGCTCGAACTCCAGTTCTCGACCTAT
        GACACCAAATGCCAATCTTTCTTCACTGAAGTCGAACCACTCATCGGCGGATCATTTGTCCAGCTTGACATCTGCAGAAG
        AACAGATGGGTTCAAATGCACGAAACCTGGGCAGTGCAGTTCCAAGTCGACCACCTAACCGCGCAGATGACGAAGTTTAT
        TGCGCCACCACACTGGTGGTCAAATCAATAATGGCGCTGTCACAAGGTGTGGAGAAAGCGAATACCGAGGGTTACTTGGA
        ATTGGTTAAGAACGTGGGCGTCAAGTTGAGAAACTTGCTAACATCGGTGGACAAAATATCTATAATATTTCCAGCACAGG
        CCCTCAAGGAAGTGCAAATGGCACATCAGGTACTTTCAAAAGACATGCACGAATTGGTCTCAGCGATGCGATTGGCTCAA
        CAATATAGTGACACAACGCTGGATTGTGAATATCGCAAGAGTATGCTGTCTGCTGCCCACGTTTTGGCTATGGACGCCAA
        AAACCTGTTTGATGTTGTCGATTCGATACGTCAACGTTATCAGCATCTATTCCCGCCATCCGCCACAAAAGAAACAAGTT
        GTTCGTCAAGTTTCGAGTCGACTTCTGGATCTATTGTCGCAGAGCCAGTTAATGACCTTGGTGGTTATATCAAGACTAGC
        ACTTCTGGAGATTTGCTTCAAAACACAGGAATATATGATAATGATTTGCATCATAGCTTCAACTCGCAATTGCAGTTGCA
        AAACCCAAAAGCCAGCATCGACTTAAGCGGCGGTGGTAGTCTACAGCGAGGGATGAGCCTTGGCTTGGACACAACCAGGT
        CGACAAACGAACCGTTGCGAATTGTTGAGGAGACCCTGGGCAGCCCGGGTGAACATATGTACTGCAATACGTCCGCCTTG
        CACGGCCACGCGTAATTCTAAAGCTTGTGTTTTTTTCTATGCGAAGATAGATATTAACTTAACGATCTAACTACTGTAAA
        TACTTAATATATATCAGAATATGTATATCCCACGAACTATTCAGCGGATAATTCGCTTATTTACGTACGGAATATACATA
        GCTTTGAACATACTTACTCACTAAAAAGTTTGACGAGACCCCAACTCGGCCGGCCGCATTCTCACATCGTCATGTAGTCA
        AAATAATTTAAGAAACAAAGACACGTTTTTGATTGAAGATGGCTAGTAATAGTAATTTATAGATAATCTACTCGATCTAA
        TACAACTAAAAATTAAATTCATCATCAATTCGGGTGTGTTTTAAGACATTTATATTGTGATTTATAGTTTACCATTATAG
        GCTTTACTCGAAGCTAATTATTTTGGTGCAAGGTTCAATCACAAAAAATAAAAAGATTAACT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0086542
        4713
        FBtr0086543
        4499
        FBtr0086544
        4240
        FBtr0114605
        5613
        FBtr0301882
        4707
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0291097
        1200
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0085726
        1200
        FBpp0085727
        1200
        FBpp0085728
        1200
        FBpp0113097
        1500
        FBpp0291096
        1198
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        Fak-RG
        Fak56D-RG
        Secondary FlyBase IDs
          References (0)