Open Close
General Information
Symbol
Dmel\shot-RQ
Species
D. melanogaster
Annotation Symbol
CG18076-RQ
FlyBase ID
FBtr0301964
Feature type
Associated gene
Evidence Rank
Length (nt)
16892
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 56 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTTGTTGTCGAGACGCCGCCGCACACATTTCACGATACCTCTCCATAAATATTTGCAAAAATTGTATAGAAATAAATAA
        AACGCATGCGTTCCTCGGGAACCGCGGAATTACAAAACTGAACGAAAACAACGGGAACGCTTTTTCGTAAACCCGGAAAA
        TCTTTATAAAGTGTAATTACGAAAATCGGCGCAAAAGAAACGCGGCAATACGAAACGATCTTCTAACGAACCTTAGAACG
        AAACGACACAAAGTGAAACAAACGAAAGCATCGATAACTGCGTAAGCAGTTCGATTATAACGATAACATGCACTCCAGCT
        CACAATCGACGCTGAAGCGCACACAACAACTGGTGCGGCAGACAAATGGTGGCAGGGGCGATGTTCTGAGCAGCGGATCC
        GAAGTGGTTCACTCCTCCCGAGGACCGGCAATAACCACCAATATCGATGACTCGAACTTGCGCTATCGTCATGAGACAAA
        AAGGGAGCGCACTGTGGAAGCGGTGATTACGGATTATCCAGGTGTATCACCCCTTGGTAGCGTTCCCCATGAACGAACCA
        ACTTTGAGCGCACTGTGACCTTCCAGGATCCCACGGGAAATTCACGTCGCCTCTCGGAGACTGGAGCTTTGGTACCGGCC
        GGTGCAATTCCAACGTCGTCGACTCATTACCAACAGGTGACGCGAAATAAACGCATCTCCACAGAGGTATTGGGCTCCAG
        CGTGGAAAGCACCAAGACATCGCAAAGAGCGCCAAATGGCCATCGCCGTGTAACCACGCACATTGTCCGGAAAGTGACCA
        CTTTGAGCAGGGCGGAGGAGAATGCTCAGCCTGCCGAGGATTTGTTGCCTCCGGCTAAAATGATTCGCAGCTCGGAGTTG
        GAGTATCGTCGCGCCCTGCCGCCGGCTATAGAGTCGTCGTCCACGCAGCGCAGAGAGATCTCCGATATTGTTGTGGGCAA
        AGAGGACAACGTATCCGCTCGGGAGGCTCTGCTGCGCTGGGCACGTCGCTCCACTGCTCGGTATCCGGGCGTACGTGTCA
        ACGACTTTACGTCGTCGTGGCGAGATGGATTGGCTTTCTCGGCGTTGGTGCACCGCAACCGACCGGACTTGCTTGACTGG
        CGAAAGGCAAGGAACGATCGGCCACGGGAGCGCCTGGAGACGGCCTTCCACATTGTGGAGAAGGAGTACGGAGTTACGCG
        TCTGTTGGATCCTGAGGATGTGGATACCAACGAGCCGGATGAGAAGTCCCTTATCACGTACATTTCATCGCTGTACGATG
        TGTTCCCGGAGCCACCCTCTATCCATCCACTCTTTGACATGGAGTCACAACGTCGCGTTCATGAATACCGCGACCTGGCC
        CAACAGTTCATCTACTGGTGCCGCGAGAAGACCGCCTACCTGCAGGAGCGTTCCTTCCCGCCCACGCTAATTGAGATGAA
        GCGTCTGTTGAGCGATCTGCAGCGTTTCCGCAGCGACGAGGTAAGCGCCCGCAAGCGCGAGAAATCCAAGCTCATCCAGA
        TCTACAAGGAGCTGGAGCGCTACTTCGAAACAGTGGGTGAAGTCGACGTAGAGGCTGAACTGCGGCCGGATGCCATCGAG
        AAGGCCTGGTATCGCATGAACACGGCGCTGCAGGATCGCGAGGTTATCCTTCAGCAGGAAATTGAGCGACTAGAACGGCT
        GCAACGACTGGCCGATAAGGTTCAGCGCGAGATCAAGCATGTAGATCAGAAGCTTACCGATCTTGAGGGCCGAATTGGCG
        AGGAAGGTCGCCGCATCGAGCGACTACATCCCGTGGACGCTAAGAGCATTGTCGAGGCGCTTGAAACCGAGATCCGGCAC
        CTGGAGGAACCCATCCAGGACATGAACCAGGACTGCCACGTGCTCAACGAGGGTCGCTATCCTCATGTCAGTGAGCTGCA
        CAAGAAGGTCAACAAATTGCACCAGCGTTGGGCTCAACTGCGCACCAATTTCCACACGAACCTGGTACAGAAGCTGTCCG
        GTTTGAAGTATCCCGTCCACGAGACCACGGTGACGCGTCAAACGCGCATGGTGGTCGAGTCCCGTCAGATCGACACGAAT
        CCCCATTTCCGCGATCTGCAGGAGCACATTGAGTGGTGCCAAAACAAGTTGAAACAATTGCTTGCCGCTGACTATGGCAG
        TGACCTGCCGTCGGTCAAGGAGGAACTGGATCGCCAACAGCACGAGCACAAGATCATTGATCAGTTCCACACGAAAATAC
        TCAACGACGAACGTCAGCAGACCAAGTTCTCTGGAGATGAGCTGGCTTTGTACCAACAGCGTCTCAATCAGCTGCAGAAG
        GTGTATGCCGAGTTGCTTAGCACCTCGACGAAGCGTCTGTCCGATTTGGATTCGCTGCAGCACTTCCTGGGACAGGCCTC
        GGCGGAACTGCAATGGCTTAACGAAAAGGAGCAGGTGGAGATTACGCGCGACTGGGCGGACAAACAACTCGATCTTCCCT
        CCGTGCACAGATACTACGAGAACCTTATGTCCGAACTGGAGAAGCGTGAGATGCACTTTGCCACCATCCTGGATCGTGGA
        GAGGCACTGCTGAACCAGCAGCATCCGGCCTCCAAGTGCATCGAAGCCCATCTGACAGCCCTGCAACAGCAATGGGCGTG
        GCTGCTGCAGCTAACACTCTGCTTGGAGGTTCATTTGAAACACGCCACGGAGTACCATCAGTTCTTTGGCGAGATCAAGG
        ATGCCGAGCAGTGGCTGGCCAAGCGTGACGAAATACTCAACAGCAAGTTCTCACAGTCAGACTTTGGCTTGGACCAGGGT
        GAAACTCTACTCAGGGGAATGCAGGATTTGCGCGAGGAACTGAATGCCTTTGGCGAGACAGTGGCCACACTGCAGCGAAG
        AGCCCAGACAGTGGTGCCTCTAAACAAGCGACGACAGCCGGTAAATCGACAAGGACCCGTGCAGGCCATTTGTGCCTACA
        AACAACAGGGTCAACTGCAGATCGAAAAGGGCGAGACTGTTACGCTGCTGGACAACTCGGGACGTGTGAAGTGGCGCGTG
        CGCACTGCTAAGGGGCAGGAAGGACCCATACCGGGCGCTTGCCTGCTATTGCCACCTCCTGACCAGGAGGCTATCGATGC
        CGCCGAACGTCTGAAGCGTCTGTTCGATCGATCAGTAGCTCTTTGGCAGAAGAAGCATCTGCGACTGCGCCAGAACATGA
        TCTTCGCCACCATTCGTGTGGTTAAGGGCTGGGACTTTGACCAGTTCTTGGCCATGGGTCCTGAGCAGCGCACGGCCATC
        CGGCGTGCCCTCAACGACGATGCCGACAAATTGCTGAGCGAGGGTGATCCAAACGATCCGCAGCTGCGACGCCTGCGCCG
        TGAAATGGACGAGGTCAATCGCTTGTTCGATGAGTTCGAGAAGCGTGCGCGCGCCGAAGAGGAGAGCAAACAGGCCAGTC
        GCATCTTCACCGAGGAATGCCTTGCCATCAAGAGCAAACTGGAGGACATGGCCCGTGAGCTGGATCAGATTATACTGGCT
        CCGTTGCCACGTGATTTGGACTCTTTGGAGCATGTGCTGGAAATTCATTCGGACTACGAGCGCAGGTTGCACCTGTTGGA
        GCCTGAGTTGAAACACCTGCAGGAAACATTCCGCACGATTGCGTTGAAGACGCCAGTGCTGAAGAAGAGCCTGGACAATC
        TAATGGAGCTGTGGAAGGAGCTGAACACTCAAAGTGGCCTGCACAAGGACCGTCTGAAGTTGCTTGAGGCTTCGCTGGCT
        GGTCTGGAGGACAATGAGCATGTGATTTCCGAACTCGAGAACGAGCTGGCCAGGCACCAGGATCTGCCATCGACCGCTGA
        GGGCCTGCAGCAAGTGTTTAAGCAACTGAACCACATGCAGGACATCATTACACAACAGCAGCCGCAAATGGATAAGATGA
        ACGATGCGGCCGATCAGCTGGGACGCATGGGAGTGCCCACCAAGGTGCTCGGCGACCTCAAGAGACTGCACTCGAACGTG
        GAGCGCCTGAACACGCGCTGGAGTGCGGTGTGCAACCAATTGGGTGAAAGAATGCGCTCATGCGAGACGGCTATCGGGCT
        TATGAAGAATCTCCAGTCGAGCGTGCAAGTGGAGGAATCATGGGTGGATGGCACCACGGAGCGACTGTCTGCCATGCCCA
        CCGCCACTTCGGCATACGAACTAGATCAAGCAGTATTCGAGAAGTTCAACATGTGCGAAGAGAATGTCAACGATCTGTTG
        AAATGGGTTACCACTGTGGAACAGAAAATCTCAAGTGTCGGCGGACCTCGTGAAAAGATTGATGAGTTACGCAACCAGAT
        TAATGCCCTTAAGCAAATCAAGGATGAGATCGAGTCTCAGCAACGGCCAGTTGCCACTTGTTTGGAGCAAATCCGTCAGA
        TCGTGCTCACCGGTGGTGATGTTTTGTCTGCCCCCGAAGTGACCACTCTGGAGAACTCTGGCCGGGAGTTGCGTTCGCGT
        GTGGATCGTGTCAACGATCGCACCGTGCGTTTGCTCCGGCGCCTGGAAGCAGGTCGAGATGAGCTCACCAAACTGCGCAG
        CGAATTGGATGTATTCTCCGATTGGTTGCAAGTCGCCCGACGCACTTTGGAGGACAAGGAACGTTCCCTGTCCGATTTGA
        CTCGGCTGCCCTCTCAGGCCGATTCGGTTCGTGAGTTTGTCAGCGATGTGATTGGGCACCAGGCCGATCTGCGGTTCATC
        ACAATGGCCGCACAGAAGTTTGTGGACGAGAGCAAGGAGTTCTTGGCCATACTGAACGACTTCCGTACTTCACTGCCCGA
        ACGCTTGCCACATGTTGAGCCACTGTCCAGTGCCGAGAGTCCCATACGCCAAGAGGTATCGCTGGTCTCGGCACAGTACA
        AGGATCTGTTGAACCGTGTGAATGCTCTGCAAGATCGCGTCTCCGGTTTGGGTGGACGCCAGCGTGAGTACCAGGATGCA
        TTGGACAAGGCTAACGAGTGGCTGAGGAGTGTACATCCGCGTGTGTCGCGCATTATCTCTGAACCGATTGCCGGCGATCC
        TAAGGGAGTACAGGATCAGATGAACGAGGCCAAGGCTCTACACAATGAGCTGCTTTCTAGTGGTCGCTTGGTGGACAATG
        CGCAACAGGCACTTGATAATCTGCTGCGCAGCCTTGGTGGCCAACTCAGTCCCATGGAGATCAATCAGTTGGAACTGCCT
        ATTGCCGATCTGAAGAACAACTACCAGCAGCTTCTGGATAATCTTGGTGAGCACTGCAAAACTCTGGACAAAACTTTGGT
        GCAATCGCAGGGCGTACAGGATGCCTTGGACAGTCTTGTGGGATGGGTTAACCAGGCCGAGGATAAGTTCAAGATGAATC
        TGCGACCCGCCTCGCTTATCAAGGAGCGTCTGCAGGAGCAGATCCGCGAGCACAAGGTCCTGCTAGCCGATCTTCAATCT
        CACCAGGCCAGCATCGACAGCGTTCAAGTTTCGGCCAAACATCTGCTTGCCAGCGCATCGAATGCACGCATTGCCAAGAA
        GGTGGAATCGAATCTAAACGATGTGACCGTCAAGTTTGAGAAGCTCTACGAGAAGGCCAACAAACGTGGTGAATTCTTAG
        ATGACGTTTACAACCGATTAAGCCGCTATCTGGATGAAATCAGCACCGTGGAGCAGCGTATGGCCAGCTTACAGGAGGCT
        CTAGATAGCCGCGAGACAAGCCTGCTTTCAACTGAAGAGTTGGCTCGCCGCATGAACGAACTGTCGCGTGACAAGGACCA
        ACTGGCTCCGCAGTTTGAGGATTGCGTGCGCAGTGGCAAGGATCTAATTAGCCTGCGTGATGTCACCGATACTGGAGTTT
        TGCGCGATCGCATCAAGGCACTGGAATCTCAGTGGCGCAACATTAACATCAGCATCGATGAGCGCGCCAAGCTGTCCAAG
        CAAAAGGCCGAACAACAACTGGCCTACGAGGGACTGAAGGATCAGGTCCTCTCCTGGCTGGCCAGCACTGAAGCGCGAGT
        TAACGGCCTTCCGCCGGTAGCAATCGATCTGGACAGGATTAAGCAGCAGCATGACGAGCTGAAGCCCATATGCAAGGATT
        ACCGCGACTATGCACCAACTATTGATAAAATTAACGATATTGGAGCACAGTACGATGCGCTAATCCGTCCAGAGAGTCCT
        GCCCGCAAACGCTCCACTTATAGTCCGATTAAGCGGACCAGTCCGTTGCGCCGCATGTCCGGAGACGCTAGAAGCCCCAG
        CCCCACCAAGGGAGGCATCCTGTCGCCACTATCGACTGGTTCCAGTGGATTCGGTAGCCGCAGATCCTCCCAGGATGGTT
        TCCAGCTGTCTGAGCTATCTCCGGTGCAGCAGCAGCTGAGCGAGATCAACAATCGCTACGGGCTGATTGGCGTGCGTCTC
        AATGACCGCCAACACGAGCTGGACAACCTGAACGAGGAACTTCGCAAGCAGTACGAGAATCTGAAGGGACTAGCTCAGTT
        CCTGGAGCGCATTCAGCGCCAATTGCCCAAGGAGTCCGTATCAAACAAGGATGAGGCCGAGCGCTGCATTAAGCAGGCGC
        GCAAGATCCTCGAAGACATGTACGAGAAGCAGAGTCTTCTTGACACCACCAAGGCTCAGGTGAAGGATATCCTCCGCCGC
        AAGTCAGATGTGCCCGGTGCCGAACAATTGCGCCAGGAGAACGATAGCATCCAAGAGAAGTGGAAGAATCTCAACGACAT
        CTGCAAGAATCGCATTGCCTTCTCCGAGAAGCTGCGTGACTTTTTGGACACCCATGGAAATCTGAAGAGCTGGCTGGACA
        GTAAGGAACGTATGTTAACCGTGCTGGGACCCATCTCTTCCGATCCCCGTATGGTCCAGAGCCAGGTGCAGCAGGTGCAA
        GTGCTTCGCGAGGAATTCCGCACTCAGCAACCACAACTGAAGCATTTCCAGGAGCTTGGACATGATGTTGTCGACCATTT
        GGCCGGCACACCCGATGCTCAGGCGGTCGAAATCAAACTGAAGGACATTCTGGGCAAGTGGGATGATCTGGTTGGAAAGT
        TAGACGACCGGGCCAATAGTTTGGGCGGTGCTGCTGACAGTTCCAAGGAGTTCGATGCTGCTGTAAATCGCTTGCGTGAG
        GCTCTGCAGAACATAAGCGATAATCTGGATACTTTGCCCACGGATGGCGATCACCAGGAGAATCTCCGCAAAATCGAGAA
        CCTGGAGCGACAGCTTGAGGGTCAACGCCCGCTGTTAGCCGATGTGGAACAATCCGCCGCCACTCTATGCAACATTCTGG
        GTGATCCCGCCTCGCGCGCTGATGTCAACTCTCGTGTCGCAGCTCTGGAGAAACAGTATTTGGCCCTTCAGAAGAAACTG
        GATACCAAGAAGGCAGAAACAGAGGCTTCCCTTCGGGATGGCCGCCACTTTGCCGAGAATTGCTCAAAGACTCTTGGTTG
        GTTGGGCGGAGAGCTCTCCAACCTGACCGACAGGCTTTTGGTCTCTGCACACAAGCCAACACTGCAGCACCAGATTGACA
        CCCATGAGCCGATCTATCGTGAGGTAATGGCCCGTGAGCATGAGGTTATTATGCTAATCAACAAGGGCAAGGATCTAACC
        GATCGCCAGCAGGATCGCGGAGTTAAACGTGATTTGGATCGCATCCAGCAGCAGTGGGAGAAACTGCGCCGTGAAGCCGT
        CGATCGACACACACGACTGCAGACGTGCATGGAGCACTGCAAGAAGTACTCCCAAACTTCGGAGACATTCCTGGCCTGGC
        TGCGTACCGCGGAGGATAAGTTGGCTGATCTTACACCCGGCGTATTGTCGAAGGCAAAGCTGGAGACGCGTCTGCGTGAT
        CTGCAGACCTTCCGTAGTGAGGTTTGGAAGCATTCCGGTGAATTCGAAAACACCAAGGGATTGGGAGAGACATTCCTCAG
        CAGCTGCGACATCGATAAGGAACCCATTAAGGCGGAACTTCAAGACATCCGCGATCGTTGGGAGAGACTCAACAATGATC
        TGATTGCCCGTGCTCATGAAATTGAAAACTGCTCGCGTCGTTTGGACGATTTTAATGATGAGTTGCGAAACCTGGATCAT
        TCTTTAGGTCGTTGCGAGGATCGACTTGCTGCCCACGATGCTCTCGGTGGAGCTGCCAAGGATCCCAAACTTTTGGAGCG
        TGTTAAGGCCATACGCGAAGAGCTCACTAACTTGAGCAAGCCTTTGCAGTCACTTAAGGCTCTGGCCAAGGATATCAGTG
        CTGAGGCTAGAGCTGCTGGCGGAGATGCTGATCATTTGACCAGTGAAGTCGATGGCCTGGCCGACCGCATGTCCGAGCTA
        CAGGGTCGCCTGGATGATCGCTGCGGAGAACTGCAATCTGCAGCCACCGCCGTATCCCAATTCAACGAACAAATGAAGAG
        TTTGGGCATTGATCTGAACGATCTGGAGACCGAGATTGAAAAGCTTTCACCGCCCGGTCGAGAAATCAAGATTGTCCAAG
        TGCAAATCGACGATGTTGGCAAGATCCAGACCAAATTGGATCGCCTTGTGGGTCGTTTGGAGGATGCAGAACGTGCCGCT
        GATGTTTTGGTAGATGCAGGATTCGCTGCAGACACCACCCAGACCCGTGAGCAAATCTCCACGCTGCGTAAGACATTGGG
        TCGTTTGGACAACAGAGTTCGCGATCACGAGGATAATCTTCATTCCACTTTGAAAGCACTTCGCGAATTCTACGACCATC
        AATCGCAAACTCTGGATGACATTCAAGACGTAAGCGATGAGTTCAAGCGCATGAAGCCCGTTGGCTCGGAGTTGGATCAG
        ATTCGCCGCCAGCAAGAGGACTTCCGTAACTTCAGGGAGCGCAAGGTGGAACCACTGGCCATCAATGTGGACAAGGTAAA
        CGTTGCTGGCAGAGACCTAGTGCGTTCGGCTGGCAGTGGTGTTTCTACCACGGCCATTGAGAAGGATCTGGAAAAGCTAA
        ACGACCGCTGGAACGATTTGAAGGAGCGAATGAACGAGCGCGATCGCCGTTTGGATGTGGCTCTGCTGCAATCTGGAAAG
        TTCCAGGAGGCGTTGGCCGGTTTATCCAAGTGGCTCAGCGACACCGAGGAGATGGTGGCTAATCAGAAGCCGCCTAGCTC
        CGATTATAAGGTGGTAAAGGCACAGCTTCAGGAGCAAAAGTTCCTCAAGAAAATGCTTTTGGATCGTCAAAACTCTATGG
        GCTCTCTAGCCAATCTCGGCAAGGAAGTTGCCAACCACTGTGAACCCGGCGAACGTGCCTCCATTGAGAAACAGTTGAAC
        GATTTGATGAAACGCTTTGATGCCCTGACCGACGGAGCCGAGCAACGTGAGTTGGATCTTGAGGAAGCCATGGAAGTGGC
        TAAGCGATTCCATGACAAGATTAGTCCCTTGGAACTTTGGCTGGACAACACGGAGCGATCTGTTAAGGCAATGGAACTGA
        TACCTACTGACGAAGAGAAGATCCAGCAGCGAATCCGCGAACACGACCGTCTACACGACGAAATCTTGGGAAAGAAGCCC
        GACTTTTCCGACCTTGCCGATGTCACCGCCCAGCTGATGCATTTGGTTAGCGACGAGGAAGCCGTTAATCTGGGCGAGAA
        GGTGCGCGGTGTGACAGAGCGGTACACAGGATTGGTGGATGCCAGCGACAACATTGGGGCTCTGCTAGCCGAATCACGCC
        AGGGATTGCGTCACTTGGTCTTGAGCTATCAGGATCTGGTGGCCTGGATGGAAAGTATGGAAGCCGAGTTGAAGCGCTTT
        AAGTCCGTTCCCGTTTACGCTGAAAAGCTGCTGGAACAGATGGATCATCTGTTGGAGCTAAACGAGAACATTGCCGGTCA
        CGCTTCGAATGTGGAATCTACTGTGGAATCCGGAGCCGAGCTGATGAAGCACATTTCCAACGATGAAGCTATCCAACTGA
        AGGACAAGTTAGACTCCCTGCAACGTCGCTATGGCGATTTGACCAACCGTGGTGGAGATCTGCTGAAGAGTGCACAGAAT
        GCACTACCATTGGTGCAGCAATTCCATGAAGCTCACAACCGTTTAGTGGAATGGATGCAAAGTGCTGAAGCTGCTCTTGC
        TCCCAGCGAGCCACGTCAAGCTGATGTGCTTCGGCTGGAGGGTGAATTGGCTGATATGCGTCCTATTCTGGACAGTATCA
        ATCAAGTGGGACCCCAGCTGTGTCAGCTTTCTCCGGGAGAAGGTGCTGCCACCATTGAGAGCATTGTGACCCGGGACAAC
        CGTCGCTTCGATTCCATTGTGGAGCAAATTCAACGCAAGGCGGAGCGTCTCCACCTGAGCAACCAGCGCGCCAAGGAAGT
        GACAGGTGACATTGATGAACTGCTTGAGTGGTTCCGCGAAATGGACACCACTCTTCGTGAAGCCGATCTGCCTGCCATGG
        AGCCCAAGTTGGTGCGTGCCCAATTGCAGGAGCATCGTTCTATCAACGATGACATTTCCAGCCAGAAGGGACGTGTACGA
        GATGTTACTGCGGCCTCCAAGAAGGTGCTCCGCGAGTCCCCACAGAGCGAGAACACCGCCACTCTTCGTGAGAAATTGGA
        TGATCTGAAGGAGATCGTCGACACTGTTGCTCAATTGTGCAGCGAGCGTCTGGGCATCCTGGAACAGGCTCTGCCCCTGT
        CTGAACATTTCGCCGATTCCCATCAGGGACTCACCGCCTGGTTGGATGACATGGAGCAGCAGATTTCGCGATTGAGCATG
        CCGGCTTTGCGTCCTGACCAGATCACTCTGCAGCAGGACAAGAACGAACGTCTTCTTCAATCCATAGCGGAACATAAACC
        TCTGCTAGACAAACTGAACAAGACTGGTGAGGCTTTGGGTGCATTGGTGGCCGATGATGATGGTGCTAAGATCAACGAGA
        TTTTGGACACGGACAATGCCCGTTATGCCGCACTCCGCTTGGAACTCCGCGAACGGCAGCAGGCGCTCGAGAGTGCTCTG
        CAGGAATCCAGCCAGTTCTCCGATAAACTGGAGGGCATGCTGCGTGCTCTGGCCAACACCGTGGATCAGGTCAATCAATT
        AGATCCCCTGTCCGCTCTTCCGCAGAAGATACGTGAGCAGATCGAGGATAATGATGCTTTGATGGACGATCTGGACAAGC
        GACAGGATGCCTTCAGTGCTGTGCAGCGTGCGGCCAACGATGTTATCGCTAAGGCTGGCAACAAAGCTGATCCAGCTGTG
        CGTGACATTAAGGCCAAGCTGGAGAAGCTGAACAATCTCTGGAACGATGTACAGAATGCCACCAAGAAGCGCGGCAGCTC
        GTTGGACGACATCCTAAGCGTAGCCGAACCCTTCTGGAAGCAACTGAACAGCGTAATGAAGACCCTAAAGGATCTAGAGG
        AAACACTATCTTGCCAGGAGCCACCAGCGGCCCAGCCTCAGGACATTAAGAAACAACAGGTGGCGCTGCAGGAAATCCGC
        CATGAGATCGACCAGACCAAACCAGAGGTCGAGCAGGTGCGACGTCACGGAAGCAACCTGATGAACATGTGCGGCGAGCC
        CGACAAGCCAGAGGTCAAGAAACACATCGAGGACTTGGACAACGCATGGGACAACATCACGGCGCTGTATGCCAAGCGCG
        AGGAGAACCTCATCGATGCCATGGAGAAGGCCATGGAGTTCCACGAGACACTGCAGAACCTCCTCAAGTTCTTGACCAAG
        GCCGAGGACAAGTTTGCCCATCTGGGAGCTGTGGGTTCGGACATTGATGCCGTCAAGCGACAGATTGAACAACTCAAGTC
        GTTCAAGGATGAAGTCGATCCGCATATGGTTGAAGTAGAAGCATTAAACAGACAAGCTGTGGAACTGACGGAACGCACTT
        CACCCGAGCAAGCGGCATCGATTCGCGAACCCCTGTCGGTGGTCAATCGCCGCTGGGAGGCCCTACTCCGTGGCATGGTC
        GAGCGCCAGAAGCAACTGGAGCACGCTCTGCTGCACTTGGGTCAATTCCAGCATGCTCTCAACGAGCTGCTGGTATGGAT
        CAACAAGACCGACAGCACACTGGACCAACTGAAGCCGATTCCTGGAGATCCGCAACTGCTAGAGGTTGAATTGGCCAAGC
        TAAAGGTGCTGGCCAACGACATTCAGGCCCACCAGAACTCAGTGGACACACTGAACGATGCGGGCCGACAGTTGATTGAA
        ACCGAGAAGGGATCTGTGGAGGCGTCTACTACCCAGGAGAAGCTGCGCAAACTGAACAACGAGTGGAAGCAGCTTCTGCA
        AAAGGCCAGCGACCGTCAGCATGAACTGGAGGAGGCTCTACGTGAAGCTCACGGATATATTGCCGAGGTCCAGGATATTC
        TGGGATGGCTGGGCGATGTAGACGCAGTGATTGGAGCTAGCAAGCCTGTGGGCGGACTTCCCGAGACTGCTACTGAGCAA
        CTGGAACGTTTCATGGAGGTGTACAACGAGCTGGATGAAAACAGACCCAAGGTGGAGACGATTCAGGCCCAGGGCCAGGA
        GTACATCAAGCGTCAGAACCAAATGAAGGTCTCGTCCAGCAACTTACAGCATACACTCCGCACGCTGAAGCAACGTTGGG
        ATGCCGTGGTATCCCGTGCATCCGACAAGAAGATTAAGTTGGAAATTGCACTCAAGGAAGCCACCGAGTTCCATGACACA
        CTGCAAGCCTTTGTTGAATGGCTGACCCAGGCCGAAAAGCTGTTGTCCAATGCTGAACCCGTCTCACGCGTTCTGGAAAC
        CATTCAGGCCCAGATGGAGGAGCACAAGGTGCTGCAGAAGGATGTGAGCACTCATCGCGAAGCCATGCTGCTGCTGGACA
        AGAAGGGAACTCACCTTAAGTACTTCAGCCAGAAGCAGGACGTGATCTTGATTAAGAACCTGCTCGTGTCGGTGCAACAT
        CGTTGGGAACGAGTGGTTAGCAAGGCTGCGGAACGCACTCGTGCTCTGGACCATGGCTACAAAGAGGCTCGCGAGTTCAA
        CGACGCCTGGAGTGGCATGATGCAGTATCTGCAGGAAACCGAACAAGTGCTGGATCAAATTATCGAGGAAGCCACAGCGT
        CCAAGGAACCACAAAAGATCAAGAAGTACATTGGCAAGCTGAAAGAGACGCATCGTCAACTGGGCGCCAAGCAATCGGTC
        TACGACGGAACCATGCGCACCGGAAAGAATCTTTTGGAGCGAGCTCCCAAGGGCGATCGCCCTGTGTTGGACAAAATGCT
        GATCGAACTGAAGGAACAATGGACTCGAGTGTGGTCCAAGAGCATCGATCGCCAGCGCAAGCTGGAGGAGGCTTTGCTTC
        TTTCTGGACAGTTCAGCGATGCTCTGGGTGAGCTTCTTGACTGGTTGAAGAAGGCTAAGAGCCGCCTGAACGAAAATGGA
        CCAGTCCACGGAGATTTGGAGACGGTTCAAGGTCTATGCGAGCACCACAAGCACATTGAGCAGGATCTGCAGAAGCGCGC
        TGCGCAAATGCAAGGAGTGCTCAAGACTGGACGCGACCTGGAGCGATCTGGAAACAATCCCGAAGTTGGACGTCAGCTCG
        ATGAGATGCAGTCCATTTGGGAGGAGGTCAAGAGTGCCGTCGCCAAACGCGGCGAGCGTCTCCAGGTGGCCCTTGTTGAT
        GCCGAGAAGCTTAATGCCCGTGTCCAGGCTCTCTTTGATTGGCTGGATCATGCCGAGCACAAGCTACGATATGCCAAGAA
        TGCCCCTGATGACGAGAAGGTGTCCCGTGAAATGATGGACATCCACATGGACTTCATGAAGGACCTGCGAGTGCGCGAGC
        GTGAAAAGACCGAGACTTTTGAGTACGCCGAGGACATTATCAACAAGGCCTATCCCGATGCCATTCCGATCATCAAGAAC
        TGGCTTTCGATTATCCAGCAGCGTTGGGAGGAGGTGCGCCAATGGGCCATCAATCGTGAGTCGAAGCTGGAGCAGCATCT
        GCAGTCGCTCAAGGATTTGGACGACACCATTGAGGAGCTGTTGGCTTGGCTCAGCGGACTCGAGGGCACCTTGTTGAACC
        TGAAGCACGAACAGCTGCCGGACGAGATTCCACCCGTGGAGAAATTGATCGAGGACCACAAGGAGTTCATGGAAAACACT
        GCTCGCCGTCAAAACGAAGTGGACCGCGCATGCAAACCAAGACAGTTGCCACCAGGAGCGCGCAAGCCGTCGCGCAGCGG
        CAAGACGCCAGTCTTTAAGGGATCTCGTGACCAGGGACTCAATGCCCGCAAGGGAAGTCGTATCACGCCCACACGTGACA
        CGCCCGACAGAGATCGCCTGCCGCACTATGGCCCCCGATTCTCGCCAAGCACCTCGGGACCGGAACTGGAATTCCGTTCG
        CCACGCGCGAAGCTTCTGTGGACCAAGTGGCGCGATGTCTGGATGCTCTCATGGGAGCGCCAGCGGCTGCTTAACGATCA
        TCTTCTGTATCTGAAGGATGTGGAGCGTGCCCGCAACTTCAGCTGGGACGATTGGCGCAAGCGCTTCCTCAAGTACATGA
        ACCACAAGAAGTCGCGCTTGACGGATCTGTTCCGGAAAATGGATAAGGATAACAATGGCATGATTCCGCGCGATGTCTTC
        ATCGATGGCATACTCAATACGAAATTCGATACATCTGGCTTGGAAATGAAGGCTGTAGCCGATTTGTTCGATCGCAATGG
        CGAAGGCCTCATCGACTGGCAAGAGTTCATTGCTGCCCTTCGTCCCGATTGGCAAGAGCGTAAGCCAGCCAATGATTCGG
        ACAAAATACACGATGAGGTCAAACGTCTGGTCATGCTGTGTACCTGCCGACAGAAGTTCCGTGTGTTCCAAGTTGGCGAG
        GGCAAGTACAGATTTGGAGACTCCCAGAAACTGCGCCTCGTTCGTATCCTTCGCAGCACTGTTATGGTGCGCGTGGGTGG
        CGGTTGGGTTGCCCTGGATGAATTCCTGCAGAAGAACGATCCTTGTCGCGCCGACGAACACTTGGCCGAACTAATGCCAA
        TATTTGAGAAAATCCGCGCTCAAGACCAGGTTCCATGCGCCTTTCCCATTCACATGGGTGCCGGCGGCACGGTATTCGTC
        CGTTGCAATACCAGCCGTTCGGTGCCGCTGAGTCCACACGTGCTGCATTGTCATCCAACAACACACTGGGTACGCGAGCG
        CTCCGTCCGCTCGATTCCCATGTCACGACCGTCGCGCTCCTCACTTTCGGCCAGCACTCCCGACTCCCTGAGCGACAACG
        AGGGTAGCCATGGAGGACCTTCCGGCCGGTACACACCACGCAAGGTCACCTACACGAGCACGCGCACGGGTCTCACGCCA
        GGAGGCTCTCGTGCCGGCTCCAAGCCCAACTCGCGCCCGCTCAGCAGACAGGGATCAAAGCCGCCATCGCGACATGGCTC
        CACGCTGTCGCTAGATAGCACGGACGATCACACGCCCTCACGCATTCCGCAACGCAAGCCTTCAACGGGCAGCACAGCCA
        GCGGTACCACTCCGCGTCCGGCGCGACTTTCGGTGACCACCACCACGACTCCCGGCAGTCGTCTCAATGGCACCAGCACC
        ATTACCCGCAAAACCGCCTCCGGATCGGCTAGTCCGGCGCCCACAAGCAACGGAGGCATGAGTAGATCATCCAGTATACC
        AGCACTAACAGGCTTCGGCTTCAAACCAATTAGGCGAAACATCAGCGGTAGCTCAACGCCCTCCGGGATGCAAACGCCGC
        GAAAGAGCTCAGCGGAGCCCACATTCAGCTCCACAATGAGACGCACTTCGCGGGGAACCACACCGACGGAGAAGCGTGAG
        CCATTCCGGCTATAGGAAGCCACCGTTATGGCTGAGGACGACGACGATAGAGAAGCAAAAGAATGCCAATATTTAAACCA
        CATACAAAACACTCAACTCTACGTACTAACTACGCACTGAAGTTCTAAACTAAACCCCCCAAAAACCACTCCCCAAACTA
        ATCGAGGCTACATTAGCAATGAATGTAGCAGCAGGAACAGCACACAGTTCTACAAAAGAGACTAACTTTGAAGTGCCCTA
        ATGGATTGGTGGAGCGAAACAATTTATAGATGTTTATACTATATATATTTTGTAAAAGACACAGTTAAGATGAAAGTTAT
        GCAGACATATAGCTAGCACACAAAGTTGATCAGACAAGCAACCTACTTACGAGTACTACTACTACTAATACTACCTTTTG
        CTACTACTAATTTGTAATGCCCACTACCTTTATTCACTAGTTATACACGTTTCCAAAATTATGATTTGTATATACTTATA
        AAGCGAAAAGCAAGCGTAAATTAATGAAAAATACACTCCAAGTGCTCTACGGCAATTAAACAAACAAAAACAAAAAAAAT
        ACAAACAAAAACACATAAAAAATATCGAAAAACTTAAGTGAAAAAAATAAAACATTCGAATGAAATGCCGCGGTCTCTGC
        TGCAAACCATCTTGAGTCTCAGTTCTCCACTGGAATCGCCAGTCCGGTGGAATTCTAGCCAGGAGTGGCACGTGGCAGAG
        GCGGAACGGCCAAAAAAATAATAACTAAACCCGTTAAAGAGATAAAATTTGATTTTGTTCTGTTATTAAACTAATAGGAA
        AGTGAAAATTGTAAGCCGCATAAAGAAAATATTTAATTATATACTAAAAGTCATTACTATAAGTTTAATTAATATTTAAC
        TGTTAAGCGACAAACACACACACACACACAGATTTTGTATTGCATAATTATTATGTTTTTTATATGCAATATATCAGCGA
        ATGAATTACGATGCAGATGCAGAAGGGCGAAAGAAATCGAACCCGTTTCTATAAATACTGTAAAATACTAATACTAAATT
        ATTTTGTTGTACGAAACGAAAGAAATGCATTAAAACTCGTGTTTTGTAATTCTATTTAATTAAAACAATTCAAATGCGAA
        ATAAACATTTAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0087619
        18014
        FBtr0304850
        17845
        FBtr0304851
        13661
        FBtr0304852
        17813
        FBtr0304853
        17148
        FBtr0087616
        17791
        FBtr0087620
        16907
        FBtr0087618
        17114
        FBtr0087617
        17776
        FBtr0087621
        27842
        FBtr0273222
        17746
        FBtr0273223
        17725
        FBtr0273224
        17731
        FBtr0273225
        17969
        FBtr0273226
        17948
        FBtr0301591
        17785
        FBtr0301592
        18008
        FBtr0301593
        17801
        FBtr0304847
        17729
        FBtr0304848
        18016
        FBtr0304849
        17803
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0291176
        5155
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0086745
        5501
        FBpp0293390
        5408
        FBpp0293391
        4100
        FBpp0293392
        5462
        FBpp0293393
        5434
        FBpp0086742
        5390
        FBpp0086746
        5160
        FBpp0086744
        5201
        FBpp0086743
        5385
        FBpp0086747
        8805
        FBpp0271730
        5375
        FBpp0271731
        5368
        FBpp0271732
        5370
        FBpp0271733
        5486
        FBpp0271734
        5479
        FBpp0290806
        5388
        FBpp0290807
        5499
        FBpp0290808
        5458
        FBpp0293387
        5434
        FBpp0293388
        5463
        FBpp0293389
        5394
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        shot-RQ
        Secondary FlyBase IDs
          References (0)