Open Close
General Information
Symbol
Dmel\CG43078-RJ
Species
D. melanogaster
Annotation Symbol
CG43078-RJ
FlyBase ID
FBtr0304815
Feature type
Associated gene
Evidence Rank
Length (nt)
8673
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 26 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CGCATGGACGGACCAGCGGACTCCGTGCGCGATTTTCATTCACTTTTCACCCAACTTCTCGGTTCTCAGTTCGCGGTTAT
      ATATATATATATATATATATATACATATATAGATAATACCAAACCGACCAGTAGTTAACGAAGCAACCGGCCACCGGTTC
      ACTTGTCCAGCAGTTCATCAGTTTAACGGCGGCAGTTGGGAGGAAAACTCATCATTATCCGTAATAATCGTTAAAGTTAG
      AGCTTTTACCCCACCTCCTCCATGAGCCTCGAATTCAAACTTCGCGTTGTCACGTAATGCCCATACAATTTAATTTTATA
      ATTAAATTTTTTTGGAATATATCGTACTGAGGGGTGAAGCAAGTGCTGTCGCCATTTCTCGTGATTTTTTGGCAACCAAA
      AAGTAAATCTTAGCCAGCAACCGCATCCGCAAAAATGGAGTCGAAACGCTCGAAAAAAGGACGCAAATCTCGGCCATCTG
      AGTCCGAGCATCCATCTAACCAACAGCAGGAGCAGCAGCCACATCACCATCATCCCTGGGACGAAGTGTCGCTACCTGGC
      GCTGGAACTGGCCCCACTGAGCAGCCGACCATACTACTGATCAACGGCATCGCCAGCGATTCCCAGCTAGAGGATAAGCA
      GTCCAAAGCAGCCGCCTTAAAGTTAGCTCTCGATAACAACAACAGCGAGGCAACAGCACCAGCACCAGCCCAGCCACACC
      AAGTTCCCACCACTCCGGGTGGCTCGCATCTCCTGGACTTCGAGTCGCATCTCATCGAGAGCATTGCCGACGAGGCCAGT
      GGCGTTGGGATCAGGGAACTAACTCCGTTCGAGCAAGAATTGCAGCGGGGCACCTCCAAGGCGGGCACCAATGACACAGA
      CCCAGTCATAGAGGTAGAACCAGCTGGTGTTAGGACCAAACAGCCTGTGGAAATCTCACCGCCGGCACATCAAATCGCCG
      AGGTTGACGAGACGGCCACTCCGTCGGAGGAAGTACGTCGCACTGCCGAGCAGCTGGTGGATGAGATCGAACAGGAGCTG
      ATCCAGGCACTCAGCCGGGATGTAGACGAGGCGCAGCGCGTGCACGAGGATCAGGTCCAGCGAGATCGCGACGAGATCAG
      CGCACTCACTCAACAGGTCGAAGTCCAGTTGAATGAGCTGACCGGTATCCTTAAAAACAAGCCCCAGGCGGAGATTGTCT
      TGGAACTGCCGGCGGAGGAGGAGGAGGAGCAGAAGCCGAAGCCATTTGTCGCTGCTCCCAGTGAACTGAAGCTCGTGGAG
      GTACCCACTCCCAAAACTGAGGCTGAGGAACAGGAACGCAAGGAGTTCATCGACTCACTGCCCCAAATCGAGCAGAATCG
      CCTGCAGGGAGTCAGTGGATCCGAGGAGACGGATGCTCAAAAACTATCGGCAGACTGCAAGAGGGAGTACTACCAATCGC
      TGAAGAAGTACCTCCTGCACAGCAGCCAGGAGAAGCCGCCAGTGCCACTGCAAACATATCGCTGGGAGGACCTCAAACGA
      GCCAAGGAACGGGGCGGCTATCCCTGGACACATTTGTACAAACGCCCACTGGGACCCGATGAGCAGCCGGAAATTGTGCT
      GCTCCTGCGAAAGTCCCAGGAACTGCGTTTCAAGTCCGAGTCTCCCAAGTCCCTGAAAAAGGTACGCTACGACGAGCAGG
      TGTTGGTGAAGGAGACCGAACGCTACATACAGGACCTTTCCGAGGACGAGGCGGTAGCCACAACCACCGACGACAGCAGC
      GAAGAGTCCTCCGATTCAGAGACCGAATCGGAACGTGATCAGCACAACGAAGACGCTCTGAGTGAGTGCATCTCCTGTGT
      TTCCGACTCCGTGCTAGCGGTTGGAGGACACGCCCGACCACGTAAGACGAATCGGCTGGCCCACATCCGTGACCTCATAC
      GGCGCAGGCGCAGCGGACGCACCCACGAGGACGCCCAGTCACTGCCCGGCAACTCCGCTAATCCCAGTCGACAGAGCAGC
      GTTCACGAACTAGCCCCGCCGCCGGGATCCCTAATTCCCAACGCCGATAAGCCTCCGAAGTCCAGCAAACCCAAGCAAGG
      ATTCGACATCATGAAGAAGCTGAAGAGTCTGGCCGAGCGCCAGAAGAAACGGCTGAACATTAAGAGGATCACCCTGAAGA
      AGGACGAGAAAATCGTTCTCGGCGAGCAGCAGAAGATTATGAAGCTAAAAGCCTCACCCAAGTCGGATCGCGGTGAGATT
      CCTCACTTCATCGAGAAGCAGGACTCCGACGAAATCCTGGAACTGGTGGAGTACGATGAATCGCCATGCCGCAAGCGAAC
      CAAGGAGGAGCTACTGGAAGATCAGCCCAGTGGCAGTGGAAGAGTGCCTGAACCCGATGAGATCATCGAGCTGCCTGTGG
      TCAAGACTGAGATAGAGGCTCCCACAGTGGAAGTCACCGAGCCTGCAGAGGAAAAAGTGGATCATAAGGAAGAAAAGGAA
      TCGGAAGCAGAGGAGGACCCGCCCAAGAAAACACCTCGCATTCGGCGGGAGCATGTATACGAAGAGATTGGCCAGGCTGG
      ATCACAGGAGCTTGTGAATCAGCCAATCCTGGAGCTAGAATCTCTAAAGAAATCTCTGACGCGTCAGGACAATCTCGCCA
      TCGATGAGATCGAGGCGGCCAAGGCAGTGCCGCTGGATCGCATGGGCAGCAGCGAGGAGGAGCAGGTGACCGCCGGCAAA
      CCCGGTGCGCTATTTGCCCCCATCTCGTCCATAGACTCCACCTCGTCGGATGAAGATCGCGCCCGCCTGGCGCAACTTTC
      ACCCGTTACCGAGGAGAGTGATGAACCCATGGACATCAGTCCAGATCTGCGTCCATCCATCAAGAAGGAAGCTTCCCCAG
      CGCCCTCAGACAAAAAGGTCACCTTTTCTCACGTCGAAGACGAAGCGGAACCGCATCGTGAGGATGTCGAGCTGCCTGAG
      GATGTCCTGGAGGCGGCTACCAATGCCGCCAAATGGAAAAACGAGAGTGATCATGAATACGAGCCCGTGGGCGTGACGCC
      GGCGCACGAATCCTCGCCAGCACCTAGCCCCCAAAGCGAACTGCAGCTGCCCATGGACATCGACTTACCGCTTAGTTCCG
      CCGGGACCACACCACGCACTGAATCCCGGACTGATTATGAAATCCACACCAGTCAAGTGGACTCAAGCGCCTTGGAGGAG
      TTGCCGTTGCAGCCGGAGAATCGTCGCAAGGGTTTCATGGCTTCGGCACAGGATCGCACCAAGAAGATGCAGGATGGCAT
      ACGTTTGCAAGCTGGAAAATTACGCACACGACTCCAAACCAAGCCGAAACCAAAACCAGTTTCCGGGAGTCCAAAAGGTA
      AGGCCAAGGAGCGACGACGCTTTAAGGCTCCCGAGTTCTCGAAGATCAAGATGCCTGAGATTAGGCGACCGGATATGTCC
      AAGCTTAAAGAGCTAAAGCGACCCGAGTTCACCAAGTTTAACAAGCCGGACATGTCCAAGTTCAAGTTGCCAGAGAAGTT
      CTCCACTCTGAAGCTGCGTCGTAGCAAAAGTTTCAAGGAAAACGAAGGTGAAGTGGTTTCGGATGAAACCCCGGAAGGCA
      CTGGAGGCACAGCGTCCCCAACTCAGCCGGCGCCAAAGAAGAAGTTCGAGTTCAACTTTGGCACCTACCCACGTGCTTTT
      CGTAAGAAGAAGCCGGTAGAGGAACCAGTTGCGGTGGCCACTGAGTCATCATTGGGAACTGAAGGCCTTAGTGTGATTCC
      CAGCACGGAGACGCAACCGTCGCAGACCTCTACCAGCTCTCCGCAAGGTGATCGTGGACCCGGACCCGTTCGTTCCCGCT
      GGGCGGATAAGTTCTCCGATGTGAGCTACAACGATAGCGAAGGATCACGTTACCGACGCTACGGCAGCGAACTAGAAAGC
      TTCGACAGAGAATCCTCTCTGGAGCGACGCATGAAGGAGGATCTGGAAGGCACCGAAGATACGGCCAGTGAGGCACAGCC
      CCAACAGGAGATGGGCATTTTGGGCGTGGTGGCCGATAACAAACAGTTTGCCGAATTCGACGAGGAAAACCGGGCCATTC
      ACGAGATATCAAGTAAGAGATCCCGGGAGTTCAAGCGCCGCCCTATGGTTCATCAAGATTCTGACCTGCGTTCGGAGGAT
      AGCAGAGATGCTGAAGGCTGGACGGAGAAGGATATACAGAAGAACAAGCTACTGAGGAAGGCGGAATTGGAGGCGGAGGC
      TGGCTTTTACAAGTTCCACGACTTACAGGATGCTCAATCCACAGCCAGTTCTGGCAAGAAAGTGGTCATGGAGACAATCG
      ATGATGATGAGTTCTTCCTTCGCAAGCGTGGAATTTCCGAAGATAACATCCAGTTGCGACAGTACATCAGTGAAGCTATT
      CGCGAGGGTTACGACATGCCCAATGCCCTTAAGCATGTGGGCTACTCAGCCGAGCAGGTTCCGGCGGAATATGGTGACTA
      CGATGTGCCTCCGGCCAAGCCGCGTCGCCTCCACCGAAACTACCAGCCTGACTTCGACTCGCAGGAGTTTCAACGCAGTG
      ATTACGGCGACGATCTATCCATGTCACAAAATGGCAGTGAGTTCACTCCAAAGCGACCACTTCGTAAGGCTCGCAGTCGC
      AGCAAATACTCGATTGAGGGCAGCCAGGACATCCCCCAGGATGGTGGTAGCAGTATCCAGTACTTCGAAGATGACGAGGA
      GTACCTACGGCCGCCGGCCAGAGATCAACCGCTCACGGATTCCGAGCAGGCACTCAATAACCTCGATCTTGGCGGCAAGG
      CAGCGGCGATGATTCAGGAGGAGATGGAGCAGGAGCTACAGAATAAGCCCCGTCCGCAGGCACCGAGGCGCCAGAAGAAA
      CGCACAAGGGACGACGCATCCGTGGACAAGGATGCAGACTCCTTCATTAACGGCTTCGGTGGTAGATCAGTATCGAACAC
      CTTTTTGCAGCCACACGAAGATGTAATTGTTTATCGCACTGAACACGAATATCGTCACATACCGCTAGCCACGCCGGACA
      GATTTACGGATGCCACCTCTGCGCGCACACAGCGTTCCGAGGACGACCGCACTTCCCGTGGTGCCGACTCCCTGATTCTG
      GACGGGCACATAAAGTCCCGCGCCGAGCTGGATGACAACGAAGATGTGGGACCACGGACAAGGAGCGATGAGAAGTTCGT
      CATCGATATGCTGGAGAGTGATGGCTATGCGGTGGTCCGCAAGGAACCGCTTCCGAAGCCAACGCCACCTGCCCGCCGGA
      AGAAGTTCATACGATCGCCGGGTGAGCGGTTCGCCACGTTGCCCAGCATTCGAGGCTCTCGGGGATCACCGCCACCCGAA
      CGACCACCGCCACCACAGCAATACGTGCCCACTGAGGACTCTCCGGTGGTGCCACGCCGCAGATCCGCGGCCAGCCTGGA
      CGAGATACCGCTGATGATCAAGTCGAACTACGAGTCGCAGAAGGAGAAGACGAAGCAGCCGGAAGAGGAGGATGACTACG
      AGGAGCCGGGTGCTTTGGATCGCTCCAATTTGCAGTCGGGCGCAGTCATCAACAAGATGAAGTTCCGACCACTGCCGCCG
      CCACCGCGTCCTCCGCGCGAGAAGCGATCCACGAGAGCAGGAAGCCAGACTCACGAGAGTTACGAGGACAGTGAACAGGT
      GGCCAGTTCCAGCCAGGCGGATAGTTATGACCAGGGTGAGTTTGAGGTAGAGGTGTCCACCCAAACGGATCCGCTGCCCG
      ATGATTTTGTGTGCGAGGAGTTCGAGATCACTGAGGACATGAAGATCATCGAACCGCGACGCTCCAATGGATCGGCTAAC
      AAAACCCTTGAGGATCTGTTGCGCAGCGTAGAGGCAGCTCAGGAGCAGGATGAGGTAGATGGAGCTCGAGTTCTGTCCGA
      GGACGAGCAGCTGGCTAAAGGTCTGCAGAGATTCCGGGACGCCAATCAGCGCAGCATGTCGGAGCGATCACGGGCTTCAT
      CGCAAGCAGATCGTTCCAAGTCGCTGAGCCGGCCGCAGACGCCTTCATCGGCGGTGATCATCGAACGCCGTGTGCCCACT
      CCCAGCCTAACTGTTGGCGAGGATGATGCCACGGTGCAGGCCTCACTAATCGTTAGACCCATTAGTGCTGCCGATTTGAT
      TGACGATGATCTGCGACGGGAGGAGGAGGAACTGCGTCGTGAGGGCTTGCTCTCTGACAGCTCGGTGCAAAGTAAATCCG
      ACGTGGAGGATGAGCACGGTGAGGTGGCATTGAGTGACTACGCCGCCAGCACGGCAGATTTGGACGCAGCGGTGGAGCAA
      CTACAGCAGGCTCAGCTGGAGAGCGACTACGAGAGTAAACTGGAGGACGATGAAGTTGAACGAACCCTCAGGGACAGCGA
      GTATGAGGAGGAAAAGTTTTCGGAGCAGGAGGAAGAGCAGGAAACAACGAAATTGGAAAAGGAACTAACTGAGCAGGAAC
      TGGAGGAGGCTCTGGAGAAGGAGCTACAGGAAGCAATGGAGAAGGAGCTATCTGACTACCGCCAAAAGGAGAAGGAGCAA
      GAATCAGAGCAAGAGCAGGCCTTCTCCGAGGAGGAATTGGCTGCTTCCGAGATTGATTACCACCAATCTGAAGAGGAGCA
      AGCCACCTCCGAGGTCGGTTATCACCCATCTGAGGATGAGCATCCCTTATCCGATGGTGAACAGCCTCTCTCCGAGGAGG
      AGCACACTTTATCCGACACGGAACATACCCCGACTGAGCCCGAAACCCAGAAAGTTGAGGAAACCATTCACAAATCCACA
      GCTAGCGAACCCACCGAGGCCGAAGTTGAGCTAAAATTCGTTGCCACTTTGCCCACCGAACCAGCTTTTGGAGACAAAGA
      GGAGGAACCAGAGGAGCCTCCTCTTCCACCACCACGTCGCAAGTCCACCACCGCCCTAGAAACCATTGCCACCACAGCCC
      TGACCATAGCCGAACAGTACAGCCGCGAGCTTACGCCCATCCAGACGGTGCAATCTGCGCCAGAACCGCAATTCCCCAGT
      CGCCTGGCCGAATTAGAGGTGGAACGTCTGCGCGTCCATGCCCTGCAGGCTGGTCAGATTCAAGTATCGCAACTGCATGG
      CAATCAAGTCAAAGCAGACGATCTGCAGTGCAAGTCCGGACAACTGGTGGTGCAGAATATCGAACTCCCGCCTGGTTTTA
      TTGATGACATTGTGGAGCGGGTGCAGCGAGAGCAGCGTCCATCTTTGCTTACCACTGAAACCCAGACTAGTCGGCAGGCA
      AGTAGCGAACCCGCCACCTCCGAGAAGGAGCTGCCCGTTAAGCCACCTCGTCACAGCAAGACCACCGAGCAAGTGCCACC
      CGCATCCAATCTGGACGAGCAGACCCAGACGGATGCCGGTTTGTTGCCACTACCTCCACCGCCGACAGCCTATCCCAGTG
      TTGAGTACCTTCAGTCCTTGGCCCCACTAGCCTTCTTTAATCTGCAGCGAAGCGCAGAGGCGGAGGAAGCGGAGGACTTG
      AAATCAGTCGAGCGAAAGGCACCGCACAAATGTCGACGTCGTCATGTCCAGGAACCCCTCGAACCGGAATCAGGTTCCGA
      ACCAGAGGAACACTTGGTGGAGCGACCACGCTCGCGATCGCGTCGCTCTCGTACCCGCAGTGCTACCCAGCCATTGGATG
      AAGACTACGACGACGATCAGCCCAAGACGGTTGCTCAAGCAGGACGGAATTTTGCCTCCGCCTGCAGCCTGGAACTGGTT
      AACATTATCAACCAGCTGACGCACTATGTTCGAGGTGAAGCAATGGAGCCTCAACAGGCGACACGTAATATATCAGCACT
      GGTGATCCTCTTCATCGCGATCACGCTCGCAGTTTTGGTATTCCTGTTAACGGGGCGGCAGGTGCACACCCATCATTGGG
      ACTACTTTAATCCGCCCGGGAACGATCATGGAAGGCAGACGTGAGGGACTGTGGGCAGTCCCATCCTGGTTTTGTTATCC
      TTTGGAGCGGTATTGCATTTTGGAGCATCGAATCTGGCCAAGATACTTGGCGGGATGAAGAAACGAATTTAAACGCGGCC
      AGGTGTCCGCTCGAAACTTGAAGGCCTTAATGATACTAACAAGAAATTACTTTAGGAATGAGGTGCGCCAATGGGGGCGG
      CGTTGGGCAGGGGCGTGCCCGTGCTACTAGTCACACAAAACAATCGAAACCAGAATCCCAGTTCAATGACCCATCATCAC
      ACACATACCGACATCTAACTTGTACTAACCAGAAATATAGAGGGAACATTTTTCAACGTTGTCTACCAACGATATAGAAA
      TCTATATGGCAGAGCATAGCAACAGAAGCAACGATCATGTATTAACTATTTACTTAACTCATGCTATGTACATACATACG
      ACGTTCTCTGTTTCTTGCGAGGAGGGGGCGAGGACCACTAATAAGAACTTATTTTGTTTGCTCATCTTTTCTACCACGTA
      AGGCAAAGCGAGAGATTCAATTGTTAAACATATTGTTGTTTAATTTAGATCAAAACGTAGGAATTAATATACAAAACATA
      CAATCTTTTTCATTGAATTCATTTGAACGTTATAACTTGAAATGCGAGTACTTAGCCAGAAAGTGAACATATATATAGAA
      GCGTATTTTCAATAAAGCAAAATTATTTAAAAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0304807
      5320
      FBtr0304809
      5763
      FBtr0304808
      5318
      FBtr0304810
      6099
      FBtr0304811
      5675
      FBtr0304812
      8498
      FBtr0304813
      8664
      FBtr0304814
      8316
      FBtr0333111
      8538
      FBtr0333112
      8513
      FBtr0333113
      8255
      FBtr0340707
      10607
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0293355
      2509
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0293347
      1653
      FBpp0293349
      1709
      FBpp0293348
      1126
      FBpp0293350
      984
      FBpp0293351
      1678
      FBpp0293352
      2455
      FBpp0293353
      2540
      FBpp0293354
      1957
      FBpp0305322
      2464
      FBpp0305323
      2514
      FBpp0305324
      2428
      FBpp0309526
      2509
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG43078-RJ
      Secondary FlyBase IDs
        References (0)