Open Close
General Information
Symbol
Dmel\asRNA:CR43476-RA
Species
D. melanogaster
Annotation Symbol
CR43476-RA
FlyBase ID
FBtr0309308
Feature type
Associated gene
Evidence Rank
Length (nt)
918
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 5 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    GCTAAATTAAGGCGATTGTAAAGGTTATTTTAACGTCAAATTCATTCTGCTATGGAAACACTTTTTATCTACCTGTTAGC
    ACTGAGCTTTCGTTCGTTTTTGAACGTTTAATTTAGCAAGGATTATATCTTCAGGATTTATTCTCAAATAGATAACATAC
    TGTAGGCGGCACAAGGTATTCCCGTGTAGGCATGGGCCGCATGGAGACATCGGTGCGTCTTGGTGGTGCACTGCAGCGCC
    TTCTCGTAGGCATTGTAGTCCGGACTCAGCCGGCGCTCCGCCTGAAAATGGGATGCAATTGGATGAGCCAGCTGGATGAG
    CGGCACTTAATCATCGACCCACCTCCTCGTACACCTCGTTGATGTTCTGGAAGTTGTTGGTGCCGGGACGCTGGAGTCCT
    TTAAGCGTCTCGTAGAGGAAGAGCTCGAAGTTCTTAAACGTGTACTCGCTGAAGTTGTAGCGCCTGAGTCGCGTGCCCGT
    TTCGCCGCCCAGAAGGACACAGGACTTGTGGTAGTCGTCCACCGCCCGCTTCACCAGCACCGCCTCGTTCAGCTTACTGG
    AGCGAATCTGCAGCGACTTGAGCTCCAGGAGATGCTGGAAGATCTTGCGCTCCATGTAATATCTGCGAATGAAGGAGATT
    GAAAGCCATTAACATTGTTCCCATCATCTCCACAATCCGAATCTGAATCCGAATGAGAATAAGAAACAGCGTGTCGGGGC
    CTTGCAAAATAAATGTTAGCAAATGTACGTAAATTGTCATTTTGATATTTCGCGAGTCACAGACAAAGGCAGTCCGCTAC
    CCGCTGTTCTAACAATGCTGACAAAGGACCTTCCTCTGCTCCATCCAGGATCCAGGCCGGAGCGCAATAAAAGGCATCAT
    GTTATTAAAATTTCAAAAATACTAAAGTGCGTACGCGG
    
    Other Products of this Gene
    Other Transcripts
    Comments

    Unconventional splice site postulated (GT-TG).

    Transcript terminates at site supported by polyadenylated cDNA.

    transcript_exception: non_canonical_splice_site

    External Crossreferences and Linkouts ( 2 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    RNAcentral - A comprehensive ncRNA sequence collection representing all ncRNA types from a broad range of organisms
    Synonyms and Secondary IDs (2)
    Reported As
    Symbol Synonym
    CR43476-RA
    asRNA:CR43476-RA
    Secondary FlyBase IDs
      References (0)