Open Close
General Information
Symbol
Dmel\Gcn2-RC
Species
D. melanogaster
Annotation Symbol
CG1609-RC
FlyBase ID
FBtr0334552
Feature type
Associated gene
Evidence Rank
Length (nt)
5290
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 18 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACACTTGTGCACCACTAGCCTTCAGTACAAAATACGCAAAAAATTTTCTTTTTCCGGAAAATTAAGTGGAAAGCGCAACA
        GGTTGTTCTCTTTACGCAACAAAAACGGCAGGAGTTCGCGTAGTAACTCATTTCACATCGAATTCAAGTCGAATACAGCA
        GCAAAGTAATGCAGCACGCAGCTGATTTGGAAACAGCTGCCAGCGCAGTTTGTGAAATTGCACACCGGCTAAAATAACCC
        GGTGGGAAATCCGAAGGAACTTCCGATCCAGTATTCCAAAGCACCCAGATGTAGCCAAGACTTATCCACTAACCGGAGAT
        TTAATGCAGAAATGGCGGATGAAAAGGCCAAGGAATCCTTCCGCGAGCGGCAAGCGCAGGAGTTGGAGGTTATAAAGTCC
        ATCTTTGGCTGTGATGTGGAGGACCTAAGACCCCAGGCGAATCCTTCCCTGTGGAAGCCAACGGACATACGGATACAACT
        TACCCCACTTCGAGACTCCTCGAACGGACTGGAAACCTATGTGTGCACCAAGCTGCACGTCACCTGTCCATCAAAGTATC
        CAAAATTGCCCCCTAAGATATCTCTGGAGGAGTCCAAAGGCATGTCGGATCAGCTGCTGGAGGCCCTACGCAACCAATTG
        CAGGCTCAATCCCAAGAGCTACGTGGCGAAGTGATGATTTATGAATTGGCCCAGACCGTTCAGGCCTTTCTCCTCGAACA
        CAACAAACCACCAAAGGGATCATTCTACGACCAGATGCTCCAGGATAAACAGAAGCGCGACCAGGAGCTACAGGACATAC
        AGCGGCAGCGGGAGTCCCTGCAACGCCAGACGCTCATCGACGAGGTGGAGCGGCGCAAAGAGATGTTCAAAACGGAGGCT
        AAGAGGCGCGGCGAACCAAGGCGCAGCATGAGCGAGTCTAACCCACGGCATCCTAGCTCGTCGGAGAGCTCCGAGAACTC
        CTCGCCCTACTATCGTGGTCACATCTACCCCTCCAAATGCCTGGATCACCGCAACACGGAGACGCTCTACTTCCACAAGA
        TGGGCAGGCAGATTCAGCGTGGATGCTGCGTTGGTGAGGGTCACTCCCAACGAGGTTGCATCGCCTACACTGGCATAGAT
        ATGCACTGCGGCCAGTTGCTCTACATAACAGAATGGAACATCAAGTACAGCCAACTGGAGCAGCCATGCATCGGCGGAGG
        CAAGTGCCACTGGAGCAGCGAGTCAAAGTGCATGGGCAGTCATCGTGTGGACGAAGTGATGGCCTCCATTGAAAAGCAGG
        TGTCCTCACTGTCCCAACTACAGCACAAAAACCTCGTCTCGTACGAGTGCGTACTGTGCATCAAGCGAAAGGAAGGTCTA
        CTTGTGTATTTGGTCCAAGACTTCCTCCTTGGCACCAGCGTGTTCAGCATCTCCTCCTCGCTTGGCTGGTGCATGGACGG
        CGCACGAATGGTTGCGCGCGGCGTGCTGGACGCCTTAGTATTTCTTCACAACAAGGGTGTATCCCATAGTCACCTGCTCG
        ACACCACTGTTTTTATGGACAACACAGGCAATGTGAGGGTATCAGACTTTTCGCTCGTTCCCAATCTTCTAGAACTTCTG
        AGCGGAGCTGGACAAAGCAGCAGTTGCGGGGACTTACCCGCGTTAGGTGCCCTGGTGGAGAGTTTGATGCCCACTAACAG
        TTACGAGATGCGCGACTTTGTAGACAAGTGTAACTCGGACCGAACTCTTTCCGCATCAGAGTTATTGGAGCATCCATTCT
        TACGCTTTTACGTCGACAATGGCCAGCAGCAGGTGATGCCATTACCACAGCAGCAACATCCTAACACCGTCCAGCGCACT
        GGATCCGCCATGCCGTACCAGATACCGACACTGGCCCTAAGCCAATCCCGCCTGCGAACGGAATTCGAGGTGCTCATGTA
        CTTGGGAAAGGGTGCCTTTGGTGACGTGCTAAAGGTGCGCAACATTTTAGACAACCGAGAGTACGCCATCAAGCGCATAC
        CATTGCCCGCGAGGAGTCGCCAGCTGTACAAAAAGATGACGCGCGAGGTGGAGCTTCTTTCGCGGCTGAATCATGAGAAT
        GTAGTTCGATACTTTAACAGTTGGATAGAAAGTGTAGATGACGCAGATGCCGCTGAGATGGATAAGCTGCTGGGCGGTGA
        GTGGTCCCAGAGTCAGCAGGACCTTAGCGTAAAACCTGCCAAGTCACCACAGCTGGGGCCCACTTTAGAGGAGGACGAGG
        ATGAAGAGGACAGCTCATCCAGCATGTGGAACGGTTACATACCCAACATGGAGGACTCTGATTCGGATGGCATTGAATTT
        GTGGACTCCAACGGCAAGGTGGCTGTCTACGACGACGAAGAGCAGGAGGATTCCACCAGAGGCAAGACCAATTCGCCAAA
        ACCTTTGATGCAGGTCATGTACATCCAGATGGAGTTCTGTGAGAAATGCACATTGCGCACCGCCATCGATGACAATCTCT
        TCAATGACACGGATCGTCTGTGGCGCTTATTTCGGGAGATTGCCGAGGGTCTCGCGCATATTCACCAGCAAGGCATTATC
        CATCGGGACCTAAAGCCCGTTAACATCTTCTTGGACTCGCACGATCAGATTAAGATCGGTGACTTTGGTCTGGCCACCAC
        CAGTTTTCTGGCTCTCCAAGCCCACGACGCAGCGCCTGCGCCTGTTAACCAGATAACCAGTGCGGAAGACGGCACTGGTA
        CTGGTAAGGTCGGCACCACTCTATACGTGGCTCCCGAATTGACAGGAAATGCTTCCAAGTCTGTGTACAACCAGAAGGTT
        GATATGTACACCCTGGGAATCATTCTTTTCGAGATGTGCCAACCGCCGTTCGACACAAGCATGGAGCGGGCTCAGACCAT
        TATGGCTCTCAGGAATGTTTCCATTAATATACCGGATGCTATGCTTAAGGATCCCAAGTATGAGAAGACGGTGAAGATGC
        TTCAGTGGCTTCTCAACCACGATCCCGCCCAGAGACCTACTGCCGAGGAGCTGCTCATCTCAGACCTGGTTCCACCAGCC
        CAGTTGGAGGCCAATGAGCTCCAAGAAATGCTGCGTCACGCCCTCGCTAATCCGCAGAGCAAGGCCTACAAGAACCTAGT
        TGCCCGATGTCTTCAGCAGGAGAGCGACGAGGTGCTGGAACACACCTACCACTTGGGAAGCAGTCGAGCTATGAAATCCT
        GGAACTCGGCAATTATAATCGATGATATAGTATCCCTGAACCCAGTGATTGAGTTTGTTAAGGCTAAGGTCGTGAATTTA
        TTCCGCAAGCATGGAGCTATAGAGGTGGACTCACCGCTCTTATCCCCACTTTCCGCAAGGAACAGCACTGCGAATGCGAA
        CGCCAATGCCGTACACCTTATGACCCACTCGGGATGTGTGGTGGTGCTACCCTGTGACCTGCGGACTCAGTTTGCGCGTC
        ACGTTACCATGAACAGCGTGAATCTCATCCGGCGCTACTGTGTGGACCGTGTCTATCGGGAGGAGCGAGTGTTTAATTTT
        CATCCCAAGCAAAGCTACGACTGCTCTTTCGATATAATTGCACCCACAACTGGAAGTCATTTAGTTGATGCCGAGCTGCT
        GTCGTTGGCTTTTGAAATCACCAGTGAACTGCCCCGATTACGCGAAAAGAATTTGGCGATCCGCATGAACCACACTAATC
        TCTTGAGGGCCATCCTCATCTTCTGCAATGTACCAAAGGCTCAGTATGGAGCACTCTTCGAGGGCACCATGGACTTCATC
        GAGTCGCGCATCTCACGCTTCCAATTTCACTCGAGTATTACCGGGATTATGGAAAAGTCGCGAACATCTGCTCAAACTCT
        GATGGACATGTTGTTAGCTAACTTTCTGCTGACTGGTTCCAGAAGCACTGTGGACGATTCCGCGCTGAAATCTTTGATGC
        GTGGAAAGGGAGAAGCAGCTTCACTGGCAAGGGGAGCATTGCGGGAACTTGAAACAGTTGTGGGACTGGCTTACAGTCTA
        GGCGTAAAGTGTCCTATACACATATGGGCTGGCTTGCCCATCAGCTTCGATCGTGCCAGCAACGGTGGAATTGTGTGGCA
        GATGACCGCTGACCTGAAGCCCAATCGCTCTGGCCATCCTTCGGTTCTGGCGATTGGGGAGAGATACGACTCTATGCTGC
        ATGAATTCCAGAAGCAGGCGCAGAAGTTTAATCCCGCCATGCCAGCACGTGGAGTTCTTAGTGGAGCGGGCTTGACGTTC
        TCCCTAGACAAGCTGGTAGCTGCTGTTGGTGTGGAATACGCTAAGGATTGTCGGGCGATAGATGTGGGCATTTGCGTGTG
        TGGAACCCGTCCACCGCTAAAGGATGTGACCTATATCATGCGTCTGCTGTGGTCGGTTGGCATCCGATGTGGAATTGTGG
        AGGCCGCCAGCGAATTGGGAGATGAAGCACAGGATCTTGCCCGCCTTGGGGCGTTACATGTCATCCTGGTGGCGGAAAAT
        GGCTCATTGAGAGTGAGATCTTTCGAGAGGGAACGATTCCAGGAGCGTCACCTAACAAGAACCGAACTGGTGGAGTTCAT
        CCAGAAGATGCTGCGAAGTGATGGACTCAATGGGACCACCGTGGACAACTTCAGCCAGTTGTCAGCCTTGGGTAGTGGTG
        ACAACAGAAGCAGTGGTGGAAAGGAAAGAGAACGCGGCGAGAATGGTCTGAGCACCTCCGCATCGAATGCCACCATCAAG
        AACAACTATAGCCAGTTGCCGAATCTTCAGGTGACGTTTCTCACCCACGACAAGCCAACGGCGAACTACAAAAGGCGGCT
        AGAGAACCAGGTGGCGCAGCAGATGAGCTCAACGCTATCGCAGTTCCTCAAGAAGGAGACCTTTGTGGTCCTGGTGGTGG
        AGTTGCCGCCTGCTGTTGTAAATGCCATTGTGGGGGCCATTAATCCACGGGAAATACGCAAGCGAGAGACTGAACCGGAA
        ATCAACTATGTGATCGAGCGATTTTCGAAATACAAGCGCTACATCTCCGAGATAAACGAAGAGGTTGTCGACTATCTGAG
        CGATGCCAAGACTCCCATTGTGGCCTTGTACAGCATATCCGATTCCTACTACCGCGTCATCATCTAGCCAACATCAAATG
        CATAGAATCGGCTGAACTACTTAGTAGACCAGCCAGTAGTGTAAGCTCGAAAGTGTCACAAATTATTTTCGCCGAAATTC
        TACTTAACTGGCTGCCCTCCGTGCCATTAACACTTTTGTTTGTTTGTGCGAATCAAAATTGATGAGATTGTATGTTTCTG
        TATCCATTTC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0085787
        5737
        FBtr0334551
        5284
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0306619
        1591
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0085148
        1589
        FBpp0306618
        1589
        Comments
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Gcn2-RC
        Secondary FlyBase IDs
          References (0)