Open Close
General Information
Symbol
Dmel\Rnp4F-RF
Species
D. melanogaster
Annotation Symbol
CG3312-RF
FlyBase ID
FBtr0340477
Feature type
Associated gene
Evidence Rank
Length (nt)
3116
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 43 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Sequence
      ATTTCCTGTATTTTTTTTGGGGGGGAAAAATTGCAGTTCCACGGAAAGCGAAAAGTTTTCCACCAAAATAAACGGTTGAA
      GCATGGACGCCGACAAGCAGCTGGAAAGGCAGCTGGAGAAGGAGCTGGACGAGATGCCGGCAGAGGATTTGGACGACGAT
      GCGTATGACGAGTATGATCTGATCGTGATACCCGATCAGGGCAAGGGCTCGCCGCAGCAGGGGCACAGTGAGTCGCCGCA
      GCAGGAGGAGGAGCACAAGTCGGAGGAGCTGCGCCAACGATCGCGCCCAACCTGGCCACCGTCGTCCGCCGGCGGGGATA
      TGACCACCATTGAGTTGATCTCATCGGACGACGAGCCGTCAGTGGAGGAGACTGAGGGAGGCAATGCCGCTGGCCGTGGC
      AGAGCGCGCAATGATTCCAGCAGCAGTAGCGATGATGTGGGCGTGATCGAAGGCTCGGAATTGGAATCGAACAGTGAGGT
      GTCCAGTGACAGTGACAGTGATAGCGACAACGCTGGCGGCGGAAATCAGCTAGAGCGCTCGTATCAGGAGCTGAATGCGT
      TGCCCAGCAAAAAGTTTGCCCAAATGGTCTCGCTCATTGGAATCGCATTCAAACTGAATGATCTGGAAAAGATCGAGTCA
      TCGGTGCTGGAGCTGCAAAATTTGGCCACTGTGCCGGCTCACGTGTGGCTGAAGTATCTAAAGGCCCGCCTGGTCGTCAC
      CCAAACGGACGAGGAGCGCAAGGCATTCGAGGAGCAGTGTGCCAAAGCGTTGGGCTACTACTACAGCATACCGCTGTCCG
      AATACGTTGTCAACTACCTGGTGGATCAGGGCAACGTACAGAACCATGTGCTGTGGGCCAAACTGCTGGCGGACTACGAC
      GTGGAGCGTCCAGACTTTGGCGACAAGCTGCGTTCGCTGATATCGACAATTACGGACGAAAATGAGGCTGCCGCCTTTGT
      GGAAATGCTGCAAAAGCACTGCGTCACCTGGACGTGCAACGTGGAGCAGCGGCAGATGATCAAGTCCGTTGTGGACAAGT
      TTAAGCAACATCTGGACGAGACAACGCGTGGTTGGGATTGGTCTGAGCAACACAAGGCTCATGTCTACGATGTGGAGACA
      TTATCCCTTGACGATGACCTCAAAAACGCTGTGATCCGTTTCATATTCGAACGCTCGGTGGCCAAGTTTCCCATTGTCGA
      TGTGCTCTGGTTATCCTACATTGAGTTCATTCAGTTCGAAGGCGTCACTGTGCCGGAGAATGAGGATGAGAATGAGGTAA
      CCGCCGAAATGGTAGCCAAACGGGCCAAACGCTTGGGCAAAGGTTTTCTGCGCAACACGGAACTCGATTTGGCCAATCGT
      GGTGTGCGCAGTCATCCCAGTGTACAATTGAATCATCGTTTCCTCGACCTAATGGAGCGCTCGGACTTTGAGTTGGCGGA
      AGTGGATGAAGAGATACGTCTCATATTGCAGCGCATTGTGACCGACATGGATATGACCGTGGAGCTGCATCTGGACTATC
      TGGCCTATCGTATTCGCAACACCAATGCCAGCGATGAGCAGCAGGTCGCCAGTCTGCGTGCCGCCTTCAATCATGCTTGG
      GAGGAGCTAACCGTGCTCTACGGCGACCAGGCGGACACCAGGTACGAGGTGCTGCAGTTGTGGGCCCAAGTTGAGTACAC
      GCAACTGGGGAGTCCGGACAATGGCCGTGAGATTTGGCGCCAAATAATGGGCTATCCGGGCAGCTCGATACGCGGCCTGC
      TCTGGCTGAACTTTGCCCAGATGGAAAGCGAATACAATGGTGGCCACGGCACACGCGATGTCCTTCGCAAAGCTCTCTCG
      CAGCCCGTCCTCGAGAATGGCCTTATGGTGCAGGAGTTTTTTCGCCGCTATGAACGTTGCTATGGCACCTACGAGTCCAT
      TGCCGCCTGCCAGGCCCTCGATCTGCCTGTCGAGTATGTGAAGCCGCGTTCCCGCATTAAGCCCAACTCACAGTCGGCTT
      ATCCTCGCCAGCAGAAGCTTAAGCCGCGCCAGCAGCAGCAACAAACGAATCGTGAGCCACTGAATCGCGAGCAGCGACGT
      CGCCAGGCGCATGAGCAACAACAGCAACAGCAGCAGCAGCAGAAGCATGGCATTAAGAAGTCCAGAACCGAGCCATCTGG
      TGGAGCTACGTCACCGCCATCGAAAGTCAAGGGGCCAGCGAATGCAGAGGCCAAGGAATCGAACTTTAAGTATTCGCCCA
      ACATGGAAATCAATAAGATCTTTGTAAGAAATCTGCATCCCGCTTGCAGCAAGGAGGAGCTGCACGAACTCTTCTCGCCT
      TTCGGCACCATCAAAGATGTGCGCCTGGTGCACAAGCTAAACAAGCAGTTCAAGGGCATTGCATACGTTGAGTTCGAGAA
      GCCGGGCGAGGCGCAACGAGCAGTGGCTGGACGAGATGGTTGTCTATTCAAGGGCATGAATATCTCTGTGGCCATTTCAA
      ACCCACCGCCGAGGGGCACATCAGCTGTCAAGCCAAGTGTGGCGCCCAAGCGACGTGTGCCCACCTCGCTTATACCCACG
      ACTCTGGTGCGCCAAGAGGTGGCTGCCAAGAAGCTGCGCTTGCTTCTGCCCGAGCCGGGGGACATATCATCCACTTCGGC
      ATCCGTCGACGTGGCCATCAAGCGCGAGGCTAATGGAGAGGAGCAAAAAGGAGATGTTCAAGAACGAGATGAGCAAAAAG
      GAGAGGAGCAAAAAGGAGAGGAGCAAAAAGGAGAGGAGCCAAAAGGAGAGGAGCAAAAAGGAGATGATCAAATAGGAGAG
      GAGCAAAGTGGAGTGGAGCAAAAGGGAGATGAGAAAAAAGAAGAGGAGATGCCAGCTGCTGTGCCCAAGTCAAACGATGA
      CTTTCGCAAGCTATTTCTCAAGGATTAGGCGACAAATGCCGGCGGCTGAGCCCGGTGCCAGCGGCCATGGTTTAGTTTGT
      AAGACGAAGACGAAGATTTGGAGCATATATTTTTTTAGATTTAAGGCAACCTAAACAGACAAGGTTGGAGAACACTGTAC
      AAAGAGAAAAACTGTTGTAAGACAATGATTTTTGTTTCGACTCATATAAATTGGTTTCTTGATGAACCAAGTGAAG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0070752
      3323
      FBtr0070753
      3242
      FBtr0112876
      3146
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0309418
      941
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0070720
      941
      FBpp0089396
      941
      FBpp0111789
      941
      Comments

      5' UTR based on RNA-Seq and/or EST data.

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Rnp4F-RF
      Secondary FlyBase IDs
        References (0)