Open Close
General Information
Symbol
Dmel\MFS16-RD
Species
D. melanogaster
Annotation Symbol
CG10069-RD
FlyBase ID
FBtr0342884
Feature type
Associated gene
Evidence Rank
Length (nt)
2281
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 16 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GATAAGTTCGGAAATTTTATCCGCGACCTCAGCAGAAACCGCAACCCACTCCGCTGTACCTGCACCTTCCACCCCTTAAA
          GCCGAAAATGTATCTCGAACTGAGTCACCACATCACTCACCACCTACCTGTTGATCATTGTTCTTTTAGGTAGCTGGCAT
          TACTCGCAACCGAAACGGATTCGGGAACCCAGCCACCTGGACGAGCAGCACTTGCACCTCGCCCACTGTCCGCGCCGGTC
          GATGAGAGCTTCACTGGGATTGGGCAGAACGCGAAAGATGAGCAATAACTACAACGACGTGCCATTCGGCATCCGGGCTG
          TGCAGCGGCTGTCCCGACAATGCTGCACCCGCTTCCATGCCCGCAGAGATTTGCTCTACAAGATGTCAGTGTTTGTGCTA
          ACTTTCCTGGCCTACGCCTGCTATCACATGTGCCGCAAGCCCATCTCCGTAGTCAAGTCGGTGCTGCAAGGAAACTGTTC
          CACAGCGCTGGCTGCATCGGGTCAGGATTGTGGATATGCGCCCTTTGATGTTCCCGATGCCACCACACTCTTTGGAATGC
          TGGACTCGGCCTTCCTCTTCTCCTATGCCATCGCTATGTTCGCTTCTGGTTTCGTGGCGGAACGCGTTTCCCTGCGATAC
          TTCTTGTCCATGGGCATGATCCTCACCGGAGTGTTCACTTACATGTTCGGCATTGCTCGCACCTCCAATATCCATAGTTT
          GTGGTATTTCATAATAGTGCAAATATTCGCTGGCATCTTCCAGACGACCGGATGGCCAGGTGTAGTGGCCCTCGTGGGTC
          GTTGGTTTGGAAAGTCGAAACGCGGGCTCATTTTTGGTATATGGAACAGTCATACGTCTATTGGAAACATTCTTGGCACG
          CTGATAGCGGCGCATTATGTGGAATCCGATTGGGCGCTGTCGTTTGTGGTACCCGGCATTATCATTGCAGCCGTTGGATT
          TTTACTCTTCCTTTTCCTAGTGGATCAGCCGGAGATTGTGGGCTGTTATCCACAAGCCGGACAGCATGAGCGTCGCGTGG
          CCAACGAGTCTGATGTGGAACAGGACGACGAGGAGCAGGTGCGCCATAACGATGCGGAAATCAACTATAGATCTGCTCCC
          ACCGAACGTACTCCAATCCTTCCACGATCTCAACCAGAGGCGGTGCCAAGGGGTCGCGGACGTCCCATCAGTCTGATCGA
          TGCTTTATTCATACCCGGTGTGGTAGAGTTTTCGCTGTGTTTGTTCTTTACCAAGCTGGTGAGCTACACCTTCATGTACT
          GGCTGCCACTTTACATACAAAAATCCAGCACATTGGGTCCAGAACTGTCCGCTGATTTGTCCACTCTTTTCGATGTGGGT
          GGTATTTTGGGTGCAATAGCTGCGGGCTATCTATCAGATGTGAGCGGAATGTCGGCCACCGTCTGCACAGGCATGTTGTT
          CGTTGCCTCGCCCATTCTGCTGATGTATCAACAATATGGTGCATTGTCGATGACAATCAGCATAGTGCTCTTGATTGTGG
          TCGGCATCTTTGTGAACGGACCATATGCCCTGATTACAACCTCTGTAAGTGCAGAGCTGGGCCAGCACAGCTCCTTGGAG
          GGAAATGCCAATGCTCTGGCCACGGTGACGGCCATTATCGATGGTACTGGGTCAATCGGAGCGGCAGTTGGTCCACTGCT
          TGCCGGCCTTATCTCCACCGCCGGATGGCAGTATGTCTTCCACATGCTCATCGCTGCCGACATCATTGCCATGGTGCTGC
          TGGGGCGACTGGTCTTCAAGGAGTTCGCTGCACTGCGTCGTGCATCGCATCGTATTCGGATTGAATAGCAGGAAGAAGCT
          GAAGCGGATGTGGTTTGACCATATATATATTTTTGTTTCTAGCGTTCTCTGTACATACCATAGCATTTGTATAGCTAACA
          TAAAGAACGTTTTCTTTTCATTCGAGAGCATATCAGAGTGTTTCTGATCCTAGTTTTACCCATACATGTCAATACCTAAT
          GTTATTTTAAATGGAATGTTTACCATCATCTTAGGCTATCCATCAAGTTTACAATTTTGATATATTACCTACATACATAT
          ATATATATATATATATATACATACATCTATGTTGTAATCTTGTGTGTGCGCGCGTGTGTCAGAGTCTCCTCGTTTTAAGT
          GCCGAACTATCATTAGTACTAGCGTAATTCTACTGCTATGTAAATACACTTTATCGTACACTTTTCGTACCAATAAAACC
          GAATTTGACTGTTCTCCGCGGCAGTACAATTTCTCAATGGC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0071589
          2226
          FBtr0071590
          2399
          FBtr0071591
          2563
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0309685
          528
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0071515
          528
          FBpp0071516
          566
          FBpp0071517
          528
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          MFS16-RD
          Secondary FlyBase IDs
            References (0)