Open Close
General Information
Symbol
Dmel\vri-RE
Species
D. melanogaster
Annotation Symbol
CG14029-RE
FlyBase ID
FBtr0342936
Feature type
Associated gene
Evidence Rank
Length (nt)
3890
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 14 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GTTCGTTCGCCGTTGACTGAGACTTTGAAAACACGAATGCAAGCAATTGCGTCGACTGAGCCGGCGACGGTCAATTGCAG
          GCCAACAACAAATTCAGTTTTGATTCGTTTGGCTATGTGTCAACAACAACAACAACATCATCCCCAACAACAACCCACCC
          ACGTCAACAACAAAAGTGCTCGAAGATTCTTTTATCGGCGAAAAGTGAAATTTCTGTGCGGCGGCCAAAAAAAGCAAATT
          GTCTAAACCAAAACAAAAACAAAAAAGGCAAAAGATCGAGAATTTCATAACGACCAACGGCCGCGCCTTTCGTACTTTGG
          CCATTTCTTTTGTAATTTGTGGCGCAATTAGCGAAATTGAAATATGCAATTGCTCACATAAGTCCCTATGTATGTTTGAA
          TGCAAAATTCAAGAGACGCAAATAACCAGCACACAACACATTATATGTATATTGGGGTATACGAAATAATCCAATAAACA
          ACAACAAGCCGCCGGAACAAATACGAAAACACATTAAAACGACGCGATCAAAACAAAAAGCCAAAAAATTTGGCCAACAG
          CGTTTGTTCCCCGCATCCAAGCTCAAAGCAACAACAGCCATCTGCAACACCAGCAGCAACTGCAGCAGAAACTAGCGCAG
          CTGCATCACTACAGCCAGCAGAAGCTGAGCGGCAGCGACTTTCCCTACGGGCCACGCCCCCCCACCGGAGGCAAAGAGGA
          GAAGCTGCTCCTGCTAGCGCCGCCGGGCAAACTCTATCCGGAGGCGTCTGTGTCCACAGCAATGCCCGAGGTCCTCAGCG
          GCACGCCCACCAACAGCCACAACAAAGCCAACATCGCCATGATGAACAACGTCCGGCTATCCAATATATCGCCGACTCTC
          TCGATGAACGGCAGCTCCAACGAGGCTTCTAACTTGCATCCGTTGTCCATGTACGGAGGATCCATAAGTCCGCAGTCAAA
          TGACAGCGGCATGTCCGACAGTCTGGGCAAATATGTCCCGGGAAGCGGCTATGGAGATGGAATGATGGCCCAGTCGCCCT
          CACAGGGTGGCAATGGACCGCAGTCGGCGTTGACCGCCGCCCAGAAAGAGCTCTTCTCGCAGCGAAAGCAACGCGAATTC
          ACCCCGGACAACAAGAAGGACGAGAGCTACTGGGATCGCCGGAGAAGGAACAACGAGGCGGCCAAGCGGAGTCGAGAGAA
          GAGGCGCTACAATGACATGGTTCTGGAGCAGCGCGTCATCGAGCTGACCAAAGAGAACCATGTGCTGAAGGCCCAGCTGG
          ACGCCATACGCGACAAGTTCAACATCTCCGGCGAGAATCTGGTGAGCGTGGAGAAGATCCTCGCCTCGCTGCCCACCAGC
          GAACAGGTGCTGAGTAACACAAAGCGCGCCAAGATGAGCGGCAGTGGTGGCTCCTCCTCGGGCTCCTCGCCCTCGGGCAG
          TGGATCGGGCGAGGGATCGCCTCAAGGTGGCCACAATGGCTATCCGGTGGGTCCACCACTATCTCCACTGATCTACGGAC
          CCAATGGCAATGCCCGGCCAGAGGCCACGGTTAAGAGTGTCCACCACATACATCATGCGGGTGTTGCGCCGCCACCAACG
          CACCTACAACAGTTGGTTGTGCCCCAGTCCCAGACACAGCATCTCTACCAGCCACAGCCGCAGCAGCATCAGCCGCATCA
          GCAGCAGCAGATTTCCCAGCCACCGCAGCAACAACAGCAGCAGCAGGAGCCAAGTCCCAGTGCCGGCTCCAGTTCGCCAG
          TCATCTCCGATCCGCACAACCGCCCGCCAAGCACCACCATTGCCAATCTCCAGGTGCAACTGCAGCAGGCACTAAACCGC
          AATGTCAGGCCCGAGGATCTGGACAGCTTGCGCAAGGTGGTGGCCGCCGGCGCTCTATACAATGCGGCAGCCGTGGTGGG
          AGCACCACCACCGCCACCATCTGCTGGTCTCTACGTGCCCGCTCCCAGCGCCTATAAGGATCACCTGGAAGCGGCTGCAG
          CCTGGAGCCACAATGTCGAGGCTGCTGTGAGCAGCAGTGCTGTGGATGCGGTCAGTAGCTCATCGGTGTCCGGCAGTGCG
          GCCAGTGTGCTGAATCTATCGCGTCGGGCCTGCTCACCCAGCTACGAGCACATGCTCTCCTCCACCACCTCCTCCACTCT
          TTCCTCGGCCTCCTCATCGGGAGCTGTTTCCGGCGATGATGAGCAGGAGCACGAACCAGCGCACATGGCTCCACTGCAGC
          TGCAGCGAAGCAGTCCGCAGCAGGGCAGCGATGCCAACAACTGTCTGCCCCTCAAGCTGCGCCACAAGTCCCATCTCGGC
          GACAAGGATGCGGCGGCCACGGCGCTACTCTCACTGCAGCACATCAAGCAGGAGCCCAACTGCAGTCGGGCATCGCCGCC
          GGCTTGGAACGATGGCGGCGACAATTCCAGCGACGAAAGGGACTCCGGCATCTCCATCGCCAGTGCGGAGTGGACGGCGC
          AGCTGCAGAGGAAGCTACTGGCGCCCAAGGAGGCCAATGTGGTAACCAGTGCCGAGCGCGATCAAATGCTCAAGTCGCAG
          CTGGAGCGCCTAGAGTCCGAGGTGGCCAGCATCAAGATGATCTTGGCGGAGTAAGCAAGCCCCTGTCCAAGCTGGACAGG
          ATCACGACTAGGCGGATCAGGAGAGAGAGCGAAGAGACAGAGGCTCTGAAGGGATCAGAGTCGGGGGAGCAGAGCAGTAG
          ATGGCAAAGCAGAGAGTTCCATGGCGCCAGTAGTTCTCCTGGACAAAGAAGTTGGTTTAAGCATATGTTAGTAGAGATGT
          CCAAAACCGAGTGATAACTATTAGATACCGATGCATGCATGTCTCCATCTCTATGTAGAACTCTAGGGCCAGGTCTGGAC
          CACAAGGATTTGACACAAGACCCTGTGGCCCGAAACTGGCCAACACTTATCTGTGTGTATGTTTATCTATCCACTGTATT
          GAGTCTTGTAATCGTGAATGTTTAACTATATAGATCTCGTCAACTCGGAGCTAAAAAAAAATCCTTAGGGTCAGCCCAAA
          AGAATTTCTAATTTAACCTGTTTGTTGTATACACACAAGCTATTTGTTTGCATAGCTAGCTGGTGACCTGCGATGAGCAT
          CGGGGTCACCAGCCACGTTATTGTTCTCTTATGCATCCCAAGTTTCCTTATGCACAGCGAAAGTGGAGAAGATAAAGAAT
          TATTATGTTTGTAAGCAAACGTTACAAAGTATTTGCTGTTGTACATATTACACAATTAATTATATATACTATATAACTAT
          ACAGATATCTATATTCCTATCATGTACATAATTTTAGTTGCAAGCTAAGCTTATTTTATTTTATTTTATTTTACTTTGTA
          TTGAGTACTATTATTATTATTATTATTATGTAGTGAAACAAACATATACATTACACTTAAGAAACGCGTGAAGCACATTC
          AAAACGTGAGAGATGAAAGAAATCTGAAAAGAATTGATGAATAAATTCTGCAATAAATAATTTTAAATATCCTCCTACCT
          TAATGTTTGTCGTTCGCCATTTATTTATGTTTTTTGCCGCTTCGGTCACCCGTGTGGCTCACAGCGCTTCAACTAAATGT
          TATCGAAGTTTATAAAACTTTAGAAACAAAACTAAAAAAGAACTCTAAGCCACACAAAAAACACACATTTTATTTGTAGA
          CCATCTAGCTGAGTAGATCGATCGTTTGGTGTCGTAATTCGAGCATTCACTTTTAAAGCTGTATTACACTTTACAAATAA
          TCGCAGTGGAGCACACAAGAAAATACATATGACTACTACTATATACATACAGCCCTATCTATATGCATATTAAAATAACT
          CGTTTGTGTTGATCAATGAAAATAAACTATTTATAATAATGAAACAAACC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0079071
          3841
          FBtr0079070
          3058
          FBtr0300020
          3455
          FBtr0346579
          4068
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0309715
          610
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078706
          729
          FBpp0078705
          610
          FBpp0289297
          729
          FBpp0312171
          729
          Comments

          UTR(s) based on RNA-Seq data.

          Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          vri-RE
          Secondary FlyBase IDs
            References (0)