Open Close
General Information
Symbol
Dmel\asRNA:CR43413-RB
Species
D. melanogaster
Annotation Symbol
CR43413-RB
FlyBase ID
FBtr0343815
Feature type
Associated gene
Evidence Rank
Length (nt)
597
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ATATATGGTCTGACTTATGCGTCAAAGAATCGGAAACGAAATTGATTAACAAAATTTGATAAAAAATATATGCAAAAAGT
          TGCATATCTATAACTCATTTAAAATAAATTTCTAGCCCTCAGAAAATTCTTGAGAAATCGCCAATGCCGAACTTTAAACT
          GCCGCCTGGGCAGAGTATTAAGCTGCCAGGTTGAGTTTAGTTTTGTACGTGCTATAATAATTCCAGTCGCGTGAGGTCCG
          TGTGACTCCAATGGCTGCGACCCCAGGGCATTACGTTGCGCAAATCCTCATCAAAACTGCGGACGATGAGGTGGTCGGCG
          GCAGGTGGGGATAATAACAGAAATTGGTATTACGTTTTAATTGCATTTCTATGTGATGGATGCTCACTTGAAGTCGTTGA
          GTTTGTTGTGAAGGAACTTGCGAATATTCCATGGTAGGTCGTTATGCCCGTCGATTAAAGGCACTTGATCCAGAAGCTGA
          ACTGCCACTCGCAAACGCTCCTCAAAGGGTGCACCTGAGAATGGGATTGGCGATGTAATCATCCGAATTAATATGATATA
          ATTACAACATTGATTCGTTAGCAGAACATTGTGCTTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0308755
          712
          Comments

          3' end based on RNA-Seq data.

          External Crossreferences and Linkouts ( 2 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          RNAcentral - A comprehensive ncRNA sequence collection representing all ncRNA types from a broad range of organisms
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CR43413-RB
          asRNA:CR43413-RB
          Secondary FlyBase IDs
            References (0)