Open Close
General Information
Symbol
Dmel\lncRNA:CR45681-RA
Species
D. melanogaster
Annotation Symbol
CR45681-RA
FlyBase ID
FBtr0346431
Feature type
Associated gene
Evidence Rank
Length (nt)
903
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            ACTCCCAATCCCAATAGGTAATCGTGACCGTTGGAATTAGATACGCGCGCGGGGCAATCTTATGGATGTGTGAAAAAGTA
            TCTTAAAAGTAGTTACTGCCCAAAGATGCACTTCACGAATCCATCGCACAGATGAAGGGATCATAAAATCCGAACTAAAT
            CACAAGAACCAACGGATTACACGGAATTGCCCAACTCGCCATTGTTGAGATGTCCACAAGTGTTTGGGGTCAGCACACAA
            AGCGGAGCACTTGTCGCGACAATTAGCGACTTAAATCGCGAATGAGAACGAGTATCTGTATCTGTGTCTCAGTTTGAATC
            GGATTCGGATGGCGATCCGATCTGGACGCTCGCGTTCTTCAGCTGTTCCAGCGCTCAACTGAAAAGTTAACTTGGAAATT
            ACTTCGTATGCGGCCATAATAATAAGCGTACAATCATAATGCCGACACACATTCGCGCGCTCACACGTACAGCAGCGGGC
            AAAAATCTAGCATCTCAGAGTAAAGTTAAGATGTGACAAAAGCAAGCGGATGTTACTATCTTAAGTAGAAGTGAGGAAGT
            ATAAGTATATATTTCTTTCTTATACCACAAACTATATGTGTAATTAGTTATTATTTAACTAGTAAATTGTATTTCGTTGA
            CTTCACTTGTGAGCACGAGTGTCGGGCACAAACAAACGCTCACACCTAAATCCAAAGAACTTTTGTTCTCTTATTGTGCT
            TGTAGAATGCACTCAGATTCTCTCAACGCCATTTGTGTCATAGTTACCGCTAAAGAAAAGAACAGCAGCCATAGACAACC
            TATAACAAACCTCTTGGGAAAACGAAGATCGGCGGAACGACTTTTTTCGTTCGCTTAGCTGCTCACCGCGGAATTAACCA
            CTTAGCGACTGCACTGTAATTTC
            
            Other Products of this Gene
            Other Transcripts
            Comments

            Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

            External Crossreferences and Linkouts ( 2 )
            Crossreferences
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            RNAcentral - A comprehensive ncRNA sequence collection representing all ncRNA types from a broad range of organisms
            Synonyms and Secondary IDs (2)
            Reported As
            Symbol Synonym
            CR45681-RA
            lncRNA:CR45681-RA
            Secondary FlyBase IDs
              References (0)