Open Close
General Information
Symbol
Dmel\Acp63F-RB
Species
D. melanogaster
Annotation Symbol
CG10852-RB
FlyBase ID
FBtr0346805
Feature type
Associated gene
Evidence Rank
Length (nt)
316
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 2 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CTTTGCAAGATGAAAGCTATCATCGTTTTTATTCTGTTCATTTCAAGTGTGCATGCTATGAGCAAATGCAACCAAGCAAT
        TTATCTAAATCTTGATCCTCACTGCGGAATACTTCCCGATTGTAACTTAGATGGTCCAAATCCAAGTTACCTCAAAAGGG
        TGTCGTGTGAACGCAAAGAAAACGGAAAACCAGGATTCATCGAACTAATTCCCGGAAAATGTCTCCATGGTAAACCGCGT
        TGCTCGTTAAAATAGTAATATTGTTCCAATATTTCCATGCATATATGTTTCAATTAAAGGCATTATAAATACCTAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0073182
        401
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0312380
        81
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0073038
        81
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Acp63F-RB
        Secondary FlyBase IDs
          References (0)