Open Close
General Information
Symbol
Dmel\CR46273-RA
Species
D. melanogaster
Annotation Symbol
CR46273-RA
FlyBase ID
FBtr0445175
Feature type
Associated gene
Evidence Rank
Length (nt)
501
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 5 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATGATCTGATCTGGAGTGCGTGACGGACTGGACACGCCCGTCGACGTCGGTCAGGCCAAGGAGCAGGCCGCCCAGCTCTA
      CTCGGCCGGCGAGGCCAAGCTGGGAACGGACGAGGAGGTCTTCAACCGGATCATGTCGCACGCCAGCTTCCCGCAGCTGC
      GACTCGTCTTCGAGGAGTACAAGGAGCTCTCCGGGCAGACCATCGAGCAGGCCATCAAGCACGAGATGTCCGACGAGCTG
      CACGAGGCCATGATGGCCATAGTTGAGTGCGTCCAGTCACCGGCGGCCTTCTTCGCCAACCGCCTGTACAAGGCCATGAA
      TGGCGCCGGCACCGATGACGCCACGCTCATCCGCATCATCGTCAGCCGCTCGGAGATCGACCTGGAGACCATTAAGCAGG
      AGTTCGAGCGGATCTACAACCGTACGCTGCACAGCGCCGTGGTGGCGGAGACCTCTGGTGACTACAAGCGGGCCCTGACA
      GCCCTACTTGGATCCGCCTAG
      
      Other Products of this Gene
      Other Transcripts
      Comments
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CR46273-RA
      Secondary FlyBase IDs
        References (0)