Open Close
General Information
Symbol
Dmel\CG10483-RB
Species
D. melanogaster
Annotation Symbol
CG10483-RB
FlyBase ID
FBtr0474639
Feature type
Associated gene
Evidence Rank
Length (nt)
2043
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 4 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CCAGTTGTGATGTTTACGTGAAAACGTGCGTTTCTAGTGCGACCACGTCCTCGCCATTTATCCGGATGCGGATGCAGTGC
          AGCCAGTTGTGAGATCCCCCCAATTCCCGAGATGAAGTTCGCCGAGCACCTGACGGCCCACATAACGCCCGAGTGGCGAA
          AGCAGTACATTAACTATGAGGAAATGAAAGCCATGCTGTATGCAGCCATCGAACAATCGCCCTCCGCAGAACTCGTGGAG
          CGCGAGATGGTGACGCGATACTTTGCCAAATTCGATGAGGAGTTCTTTCACTACTGCGACAAGGAGCTGGCCAAGATCAA
          CACATTCTACTCGGAGAAGATGGCCGAGGCGACACGCAAATATGGCAGTCTGCGCAGCGAGTTGACCGAAGCCCTGGAAA
          TGGGACACCCAAAGAAACTGCCCGCGTGGAAGAGGCGAACGCCGCTGGGCAAGAAGAATGTGCCGGCGCGCAAGATACAG
          GATCTCAAGTTGGCATTTAGTGAATTTTATCTGGGACTGATACTGCTCCAGAACTATCAGAACCTCAACTTCACGGGTTT
          CCGTAAGATACTTAAGAAGCACGACAAGTTGCTGAGCGTCGACTATGGTGCACGTTGGCGCACGGATCACGTGGAGGCAG
          CCCACTTTTACACCAACAAGGACATTGATCGGCTGATCCAGGAGACGGAGCAGGCTGTTACCCAGGACATCGAGGGAGGA
          GATCGTCAGAGGGCAATGAAGCGGTTGAGGGTACCACCACTGGGCGAACAGCAGAGTCCTTGGACGACCTTCAAGGTTGG
          TCTCTTTTCTGGCGCCTTTGTGGTGCTCTTCATTACGGTTGTGATCGCTGCCATGTTCTACGGATTCGGCGAGAACTGGC
          GGGCCGGAATGAGGATGTTCCGCGCACCATTCCTCATCATCGAATGCCTCTTCCTTTGGGGCGTCAATGTCTACGGCTGG
          AGGTCGTCCGGTGTGAACCACGTCCTCATCTTTGAGTTGGATCCACGAAATCACCTGTCCGAGCAAAACATCATGGAAGT
          GGCATCCGTGTTTGGAGTTATCTGGGCCTGCTGCGTCCTGAGCTACATCTTTTGCGATCCCCTCGGCATCCCACAGTACG
          CAGCTCCGCTTTGCCTCTACACATTGATGGCTGCCTTTTTGCTGAATCCCACGAAGACGTTCCATCATGAGGCCCGGTTT
          TGGGCCATAAGGATCCTCATCCGGGTAATCATGGCTCCGTTCTGCTTTGTAAACTTTGCCGATTTCTGGCTGGCCGACCA
          GCTGAACAGCATGGTGCCAGCTTTTCTGGATATACCCTTTCTGATTTGCTTCTTTGGTCGAAGTCCCACATGGCACAAGG
          CTGGCAAGGACACCTACCCGCTGTCCAAGGAGAATCCTTGGTTCTACTGCTGGATTACGGCCGCCATCTTCTCGTCCTGC
          TACGCCTACACATGGGACATCAAAATGGACTGGGGACTGTTCGACTCGAAGGCGGGCGACAATCGATTCTTGCGTGAGGA
          AATCGTTTATTCATCGACGTGGTTCTACTACTTTGGCATAATTGAGGATTTAATACTGCGCTTCAGCTGGACCCTGTCCA
          TGAGTCTAATTGAGGCTGGCTACATTGAGGGCGATGTGATGATGACCATTCTCAGTCCCCTGGAGGTTTTCCGTCGCTTC
          ATTTGGAATTACTTTCGGTTGGAGAACGAGCATCTAAACAACGTGGGCAAATTCAGGGCTGTCAGGGATATATCGGTCGC
          TCCAATGGATTGCTCGGATCAGACCACGATTTTGCGCATGATGGATGAAACTGATGGCGTGTTGAATCGAAGGCGTGGAA
          AAGCCGCTGGCGGCAAATCCGCAACGAAGAAGAACAAACAGGAGCAGCGACTGCTCCTTCAAGGGGAATCCATTGAGGAT
          CTTTGCTCGTAGTTGGGTTACCCAATAAACATCTATCTCTCTGTGTGCACAAATTTTACGTTTATGGCAATAAAGCACTT
          CAGTTGCATTTGCGGACACTGAATAAATGGTCCAAATGGTTCC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0077077
          2238
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0423204
          606
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0076785
          671
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          Transcript supported by data in FBrf0239334; specific to a small number of neuron subtypes.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG10483-RB
          Secondary FlyBase IDs
            References (0)