A TI{SA-KozakGAL4} DNA cassette has been inserted into CG11737, replacing the coding sequence (coordinates of deleted sequence are 3R:8519492..8526066 , release 6 genome). This results in a simultaneous knock-out of CG11737 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG11737 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of CG31259 and all of CG31454. The TI{SA-KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTGAGAGAGATAATCGAGCCTGG and ACAGTAGGTATGCGAAGTTATGG.