A TI{KozakGAL4} DNA cassette has been inserted into CG31358, replacing the coding sequence (coordinates of deleted sequence are 3R:12029966..12031701 , release 6 genome). This results in a simultaneous knock-out of CG31358 plus a knock-in of GAL4. The deletion also removes part of CG42504 and part of CG42505. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TCAAAAATTTCTTGTAATGAGGG and CGAGCAAAGAATCTTTAGCGGGG.