A TI{KozakGAL4} DNA cassette has been inserted into Nepl20, replacing the coding sequence (coordinates of deleted sequence are 3R:28880793..28882988 , release 6 genome). This results in a simultaneous knock-out of Nepl20 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Nepl20 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of CG33203. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with a 3' homology arm of length 200bp and a 5' homology arm extended to restore the promoter. The sgRNA sequences used to target the gene were: ATTAGCTAAGCTGCCGAAAAAGG and AGGGATGAGCACTTCAGTAATGG.