FB2026_03 , released September 17, 2026
Aberration: Dmel\Df(2R)CRIMIC-CR70974
Open Close
General Information
Symbol
Df(2R)CRIMIC-CR70974
Species
D. melanogaster
Name
FlyBase ID
FBab0049406
Feature type
Computed Cytological Breakpoints (relative to progenitor)
Sequenced Breakpoints (relative to progenitor)
2R:21,654,708..21,654,708 (Df(2R)CRIMIC-CR70974:bk1)
2R:21,657,127..21,657,127 (Df(2R)CRIMIC-CR70974:bk2)
Member of large scale dataset(s)
Nature of Aberration
Cytological Order
Progenitor
Class of aberration (relative to wild type)
Class of aberration (relative to progenitor)
Cytological Breakpoints (relative to progenitor)
Carries alleles
Formalized genetic data
Genetic mapping information
Comments

A TI{CRIMIC.TG4.1} DNA cassette has been inserted into Ip6k, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. The insertion is also within asRNA:CR43786, not in a coding intron, and is not predicted to gene trap this gene. All of the coding sequences of Ip6k downstream of the inserted gene trap cassette have been deleted, and almost the entire transcribed region of asRNA:CR43786 has been deleted. The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Ip6k : one targeted to a coding intron (GAAAGCATACTCTTCTCATCTGG) and the other to a non-coding exon in the 3' UTR (GAATATATATATGGGGCAACTGG).

Comments on Cytology
Sequence Crossreferences
DNA sequence
Protein sequence
Gene Deletion and Duplication Data
Genes Deleted / Disrupted
Complementation Data
Completely deleted / disrupted
Partially deleted / disrupted
Molecular Data
Completely deleted
Genes NOT Deleted / Disrupted
Complementation Data
 
Molecular Data
 
Genes Duplicated
Complementation Data
Completely duplicated
Partially duplicated
Molecular Data
Completely duplicated
Partially duplicated
Genes NOT Duplicated
Complementation Data
 
Molecular Data
 
Affected Genes Inferred by Location (2)
Phenotypic Data
In combination with other aberrations
NOT in combination with other aberrations
Stocks (1)
Notes on Origin
Discoverer
 
Balancer / Genotype Variants of the Aberration
 
Separable Components
 
Other Comments
 
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Df(2R)CRIMIC-CR70974
Name Synonyms
Secondary FlyBase IDs
    References (1)