A TI{CRIMIC.TG4.1} DNA cassette has been inserted into CG6867, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of CG6867 downstream of the inserted gene trap cassette have been deleted. The insertion is also within an intron of Sh, and the deletion removes Sh intron sequences. The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target CG6867 : one targeted to a coding intron (ATCAGCTGGAGAGGTGCGAAAGG) and the other to a non-coding exon in the 3' UTR (CTTAAAGATCTGCAGAGTCATGG).