A TI{KozakGAL4} DNA cassette has been inserted into Golgin84, replacing the coding sequence (coordinates of deleted sequence are 3R:24355997..24357871 , release 6 genome). This results in a simultaneous knock-out of Golgin84 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Golgin84 (predicted to gene trap all annotated transcripts of the gene). The 3' end of the deletion associated with the insertion extends 73 bp beyond the annotated 3' end of the Golgin84 gene and deletes 244 of the 3' UTR of the CG6454 gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CTTAGAAAAATATGTCATCCTGG and AAAATTAGCACTACTAAGTTAGG.