A TI{KozakGAL4} DNA cassette has been inserted into ND-MNLL, replacing the coding sequence (coordinates of deleted sequence are X:7893131..7893303 , release 6 genome). This results in a simultaneous knock-out of ND-MNLL plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of ND-MNLL (predicted to gene trap all annotated transcripts of the gene). The deletion removes part of a dicistronic transcript that encodes CG45089 as well as ND-MNLL and thus expression of CG45089 may also be affected. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GGATACACAAATATACACCATGG and CGATGTTGGGCAGGCCTACCAGG.