A TI{KozakGAL4} DNA cassette has been inserted into Lztr1, replacing the coding sequence (coordinates of deleted sequence are X:924132..927526 , release 6 genome). This results in a simultaneous knock-out of Lztr1 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Lztr1 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of CG43867 (Lztr1 is nested within an intron in the 5'UTR of the CG43867-RA isoform). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ATACAATTGCATATAAAATCTGG and CGTAATGCGGCAGTAGCGGTTGG.