A TI{KozakGAL4} DNA cassette has been inserted into Coq3, replacing the coding sequence (coordinates of deleted sequence are 2L:21157554..21158564 , release 6 genome and also removes the Coq3 transcription start site). This results in a simultaneous knock-out of Coq3 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Coq3 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of Mpp6. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GGGCGTAGCCAGGTGCATTAAGG and CCAGATGTGCTACGCCTTGCAGG.