A TI{KozakGAL4} DNA cassette has been inserted into CG31199, replacing the coding sequence (coordinates of deleted sequence are 3R:20742857..20743791 , release 6 genome). This results in a simultaneous knock-out of CG31199 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG31199 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of CG42322 (CG31199 is nested within an intron of CG42322). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GCAGCTCAAAGTCAACTGACTGG and TCAGTGAGTTGGAGTTCTGTCGG.