A TI{KozakGAL4} DNA cassette has been inserted into CAH13, replacing the coding sequence (coordinates of deleted sequence are 2R:10725275..10727096 , release 6 genome). This results in a simultaneous knock-out of CAH13 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CAH13 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of Rab3 (CAH13 is nested within an intron of Rab3). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTATGTGACTGAGTTCTTAAAGG and GACCACAAATGGAGTGTCTATGG.