A TI{KozakGAL4} DNA cassette has been inserted into hay, replacing the coding sequence (coordinates of deleted sequence are 3L:10631366..10633986 , release 6 genome). This results in a simultaneous knock-out of hay plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of hay (predicted to gene trap all annotated transcripts of the gene). The insertion is also within a coding intron of CG34001 and is not predicted to gene trap this gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TGTTTAATTTCTTGAGCTCGCGG and CAAACTTTAGAAACTTTCCGTGG.