A TI{KozakGAL4} DNA cassette has been inserted into NP15.6, replacing the coding sequence (coordinates of deleted sequence are 3R:19027444..19027919 , release 6 genome). This results in a simultaneous knock-out of NP15.6 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of NP15.6 (predicted to gene trap all annotated transcripts of the gene). The insertion is also within a coding intron of GatA (gene on the opposite strand) and is not predicted to gene trap this gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AACAGCGCAGACATCGCGTTGGG and TTACATAACAGACTAAGTTTAGG.