A TI{KozakGAL4} DNA cassette has been inserted into CG16736, replacing the coding sequence (coordinates of deleted sequence are 3R:9256715..9257709 , release 6 genome). This results in a simultaneous knock-out of CG16736 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG16736 (predicted to gene trap all annotated transcripts of the gene). The insertion is also deletes a small small segment at the 3' end of the CDS and the entire 3' UTR of CG16734. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TAATGAATAATAGTGATGCGGGG and AGATTTGTGAATAAATATGGGGG.