A TI{KozakGAL4} DNA cassette has been inserted into Kdsr, replacing the coding sequence (coordinates of deleted sequence are 3R:25261229..25262451 , release 6 genome). This results in a simultaneous knock-out of Kdsr plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Kdsr (predicted to gene trap all annotated transcripts of the gene). The insertion also deletes 185bp from the 3' end of the asRNA:CR46099 gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GATTCTCTAATCTCTTACGCTGG and GGGCACTTGGGAATACTTTAAGG.