A TI{KozakGAL4} DNA cassette has been inserted into Ptp36E, replacing the coding sequence (coordinates of deleted sequence are 2L:18182029..18184198 , release 6 genome). This results in a simultaneous knock-out of Ptp36E plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Ptp36E (predicted to gene trap all annotated transcripts of the gene). The insertion and associated deletion is also within an intron of CG42750. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GATGACAACGCAGCAGCTTGTGG and GGAGCGTACTATTTGCAAACTGG.