A TI{KozakGAL4} DNA cassette has been inserted into SPH93, replacing most of the coding sequence (coordinates of deleted sequence are 2L:17454346..17455922 , release 6 genome and the 3' end of the deletion is 8 bp upstream of the stop codon of SPH93). This results in a simultaneous knock-out of SPH93 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of SPH93 (predicted to gene trap all annotated transcripts of the gene). The insertion and associated deletion is also within an intron of CG5050. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CAGAAAACTGAGTGAACGAACGG and TGCCCTTCGATTACAGGAGTGGG.