FB2026_02 , released June 18, 2026
Aberration: Dmel\Df(3L)Fit164
Open Close
General Information
Symbol
Df(3L)Fit164
Species
D. melanogaster
Name
FlyBase ID
FBab0049529
Feature type
Computed Breakpoints include
Sequence coordinates
3L:4,101,315..4,101,320 (Df(3L)Fit1[64]:bk1)
3L:4,103,931..4,103,936 (Df(3L)Fit1[64]:bk2)
Member of large scale dataset(s)
Nature of Aberration
Cytological Order
Breakpoints
Causes alleles
Carries alleles
Transposon Insertions
Formalized genetic data
Genetic mapping information
Comments

Deletion that extends from the 5'UTR of Fit1 into the adjacent CG14995 gene, removing coding sequences. The sequence of the breakpoint junction is AGTCTGAACAATAATAAACA|ATTA|CTCGGCTTGTTGGATTGTTG. The ATTA at the breakpoint junction could have come from either the left or right side of the deletion or it could have bases from both sides, so the cytological breakpoints would be written 3L:4101315..4101320 ; 3L:4103931..4103936 to reflect these uncertainties.

Comments on Cytology
Sequence Crossreferences
DNA sequence
Protein sequence
Gene Deletion and Duplication Data
Genes Deleted / Disrupted
Complementation Data
Completely deleted / disrupted
Partially deleted / disrupted
Molecular Data
Completely deleted
Genes NOT Deleted / Disrupted
Complementation Data
 
Molecular Data
 
Genes Duplicated
Complementation Data
Completely duplicated
Partially duplicated
Molecular Data
Completely duplicated
Partially duplicated
Genes NOT Duplicated
Complementation Data
 
Molecular Data
 
Affected Genes Inferred by Location (2)
Phenotypic Data
In combination with other aberrations
NOT in combination with other aberrations
Stocks (0)
Notes on Origin
Discoverer
 
Balancer / Genotype Variants of the Aberration
 
Separable Components
 
Other Comments
 
Synonyms and Secondary IDs (1)
Reported As
Name Synonyms
Secondary FlyBase IDs
    References (1)