Deletion that extends from the 5'UTR of Fit1 into the adjacent CG14995 gene, removing coding sequences. The sequence of the breakpoint junction is AGTCTGAACAATAATAAACA|ATTA|CTCGGCTTGTTGGATTGTTG. The ATTA at the breakpoint junction could have come from either the left or right side of the deletion or it could have bases from both sides, so the cytological breakpoints would be written 3L:4101315..4101320 ; 3L:4103931..4103936 to reflect these uncertainties.