76bp deletion in the 5' region removing the TATA box and an insertion of 20bp replacing the deleted segment.
78 bp region deleted and replaced by 20bp insertion in mutant.
ATTATCCTTATTTCATCATG
Homozygous GpdhMB5 flies and GpdhMB5/Df(2L)GpdhA flies have reduced Gpdh enzyme activity compared to wild-type. Fast electrophoretic variant.
Isolated from: Mission Beach, Queensland, Australia population, 1986.