Additional bases have been inserted within exon 2 so that instead of the wild-type sequence, CAAAGCTTCAGGC, the Mt2r2 allele has the sequence: CTGTAAGTAAGTAAGATCTAATAAAGAGCTTCAGGC. This introduces three in-frame stop codons and a +1 frameshift at the HindIII site.
GTAAGTAAGTAAGATCTAATAAAGAGCT
Insertion of a 28 bp oligonucleotide by homologous recombination introduces three in-frame stop codons and a +1 frameshift.
Mt2r2 homozygous flies are morphologically indistinguishable from wild-type flies.