Imprecise excision of the P{EP}G2213 insertion, resulting in a deletion that removes nucleotides -1 to +1994 of the Chd1 gene, plus an insertion of the additional sequence CATGATGAAATAACATATAGTTAGATATGAAATAA (much of this additional sequence is derived from the P-element sequences of the original insertion).
wing (with Df(2L)Exel7014)
Homozygous, Chd14/Chd15 and Chd14/Df(2L)Exel7014 animals show a 1- to 2- day developmental delay.
Chd14/Chd15 and Chd14/Df(2L)Exel7014 adults show wing notching.
Chd14/Chd15 males show normal mating behaviours and have no obvious defects in testis morphology, but no offspring are produced when they are mated to Oregon-R virgin females.
Chd14/Chd15 females produce few offspring compared to control females.
Chd14/Df(2L)Exel7014 females produce almost no progeny. While eggs are occasionally formed in these females, oogenesis often fails at stage 8.