Imprecise excision of P{lacW}ScoxSH1783, leaving 40 bp of the P{lacW} element at the insertion site, including the 8 bp P-element target site duplication and part of the 3'-5' P{lacW} terminal inverted repeat. This residual insertion generates a frameshift producing a prematurely terminated novel reading frame putatively encoding a 71 amino acid polypeptide - only the first 48 amino acids match those in the wild type nascent protein.
CATGATGAAATAACATATGTTATTTCATCATGGTCTGGCC
40 residual bases of the Pelement along with the 8 bp repeat are inserted at the site, leading to a frameshift and early translation termination after 77 aa (48 of which are from wt Scox).