Imprecise excision of P{GSV6}SMC5GS14577, leaving a 40bp insertion within the second exon.
Imprecise excision of the progenitor insertion
An insertion of 40 bp (CATGATGAAATAACATATGTTATTTCATCATGGCTCCGCC) reported at 3L:21569652 .
CATGATGAAATAACATATGTTATTTCATCATGGCTCCGCC
Eggs from SMC5P7E8/SMC5P7E8 mothers exhibit a significant reduction in hatching rate, as compared to wild type. A subset of these embryos arrest at embryonic stage 2, but this phenotype is suppressible when reared at 18[o]C instead of 25[o]C. Embryos also exhibit developmental delay and nuclear abnormalities that are not suppressible by rearing at 18[o]C, including nuclear degeneration and erroneous nuclear divisions; at stages 4-5 embryos exhibit a "nuclear fallout" phenotype wherein faulty nuclei are actively removed into the yolk; after cleavage cycles these embryos exhibit frequent anaphase-bridge formation and gaps in the embryonic cortex.
SMC5P7E8/SMC5P7E8 mutant females exhibit an increase in X chromosome non-disjunction during meiosis, and this phenotype is suppressible by rearing flies at 18[o]C instead of 25[o]C. Germaria in SMC5P7E8/SMC5P7E8 mutant females exhibit similar levels of DNA double stranded breaks compared to wild type, but these are insufficiently repaired in mutants, this phenotype is suppressed when rearing flies at 18[o]C instead of 25[o]C. Ovaries of SMC5P7E8/SMC5P7E8 mutant females exhibit increased pachytene arrest and delayed karyosome dynamics, as compared to wild type.