19bp deletion which includes the ATG translation start codon. In addition, a number of nucleotide substitutions have been introduced upstream of the deletion.
CRISPR/Cas9-induced 19bp deletion which includes the ATG translation start codon. In addition, a number of nucleotide substitutions have been introduced upstream of the deletion. GTGCCCCATCCCGTGCCCATAGCA has been replaced with aTGCCCCATCCCcatCCCccAtCA (where the mutated nucleotides are in lower case).
Under starvation conditions, AstASK1/AstASK1 (or AstASK1/Df(3R)BSC519) flies survive significantly longer than controls (including compared to AstASK1/+). AstASK1/AstASK1 (or AstASK1/Df(3R)BSC519) flies have enhanced sucrose intake (when given a choice between proteins and sugars), compared to controls.