A frameshift allele that truncates the majority of the coding potential of the gene.
GTCACTTATGATCACTTATG
Replacement of TCCA with GTCACTTATGATCACTTATG for a net insertion of 20 nucleotides in the Spn77Bc coding region.
Spn77BcSK1 mutant adults do not show any overt morphological defects, but the males show significant increase in the frequency of spermatid individualization defects and high proportion of abnormal individualization complexes.