αTub84B sequence in which the C-terminal tail has been replaced by the equivalent sequence from a vertebrate ortholog has been knocked in to the attP site present in the αTub84BKO-attP knockout line.
ACGGCGAGGGTGAGGAAGAAGGAGAGGAGTACTAA
The endogenous C-terminal tail sequence, DGEGEGAEEY, was replaced by DGEGEEEGEEY, which corresponds to the C-terminal tail of human TUBA1A, the homolog of alphaTub84B. The replacement DNA sequence is: 5'-ACGGCGAGGGTGAGGAAGAAGGAGAGGAGTACTAA-3'.