amorphic allele - molecular evidence
Deletion of 20bp (GAAATGGCCGCCAACCAGAA), including the start codon ATG of apn.
abnormal size | recessive | second instar larval stage
lethal - all die during second instar larval stage | recessive
embryonic/larval tracheal dorsal trunk | second instar larval stage
embryonic/larval tracheal lateral trunk | second instar larval stage
tracheal metamere 8 | second instar larval stage
tracheal metamere 9 | second instar larval stage
apn43/apn43 second instar larvae have a reduced dorsal trunk tube length (especially in tracheal metameres 8 and 9) and uninflated trachea tubes. There are no differences in dorsal trunk length at embryonic stages.