1452bp deletion affecting aub; 1355bp after the AUG start codon are deleted. Generated by imprecise excision of the P{lacW}aubsting-1 insertion.
A 1452bp deletion resulting from the imprecise excision of P{lacW}aubsting-1, which removes sequences between the border sequences 5' ATAACTCACATCCCTGGGCG 3' and 5' CACAAGGTTATGCGAACTGA 3'. The coordinates are reported as 2L:11000010..11001465 of AE014134.6 but this does not match the reported border sequences.