A 'HomeR' ('Home and Rescue') sequence cassette composed of 1. a snRNA:U6:96Aa promoter driving expression of a gRNA that targets PolG2 (target sequence GCGCAGCCGGGACACAAGGCTGG) and 2. a Avic\GFPEGFP.3xP3.cLa marker, has been inserted into the endogenous PolG2 locus, immediately downstream of the gene. Due to the design of the donor plasmid used, 22 codons at the 3' end of the PolG2 locus (downstream from the cut site of the gRNA encoded by the inserted HomeR cassette) have been 're-coded' so that the encoded amino acids are not changed, but the sequence is resistant to the sgRNA encoded by the inserted HomeR cassette. A p10 3' UTR has been inserted downstream of the re-coded codons to support robust expression of the re-coded PolG2 gene. Used as part of a split gene-drive system.