Two separate insertions (9bp and 1bp) within Arl6IP1; the first three bases of the 9bp insertion result in a premature stop codon.
A stop codon is introduced after amino acid 18 of Arl6IP1. This is the result of the indicated region being replaced with TGATAATAGTTGGAGCCTTTCCGGACAGCGATTGTTGGAGCC.
TGATAATAGTTGGAGCCTTTCCGGACAGCGATTGTTGGAGCC
Arl6IP1KO2 homozygotes are viable but adults show a progressive decrease in climbing ability. In third instar larvae, axon terminals of long motor neurons (i.e. targeting A7) display disrupted ER morphology, as well as significant elongation of mitochondria; axon bundles show an increased number of lipid droplets.