Amino acid replacement L283F. This change is equivalent to a L254F change in the orthologous human OGT gene, a variant associated with intellectual disability.
Six nucleotide changes affecting five codons results in an L283F amino acid change (CTA to TTC in L283 codon). The other changes are silent substitutions. Analogous mutation in human Hsap/OGT implicated in intellectual disability, X-linked.
TTCTCTCCGAACAACGCCGTG