A TI{KozakGAL4} DNA cassette has been inserted into CG17140, deleting the coding sequences of both isoforms (coordinates of deleted sequence are 2L:10843099..10844363 , release 6 genome). The deletion also affects the dicistronic transcript that encodes CG17139 and CG17140-PA, deleting much of the long 3'UTR of CG17139 (although the CG17139 promoter and coding exons are unaffected). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTGATTAAACGATCTGACACCGG and CATAGGATTGGCGTTTCCTGGGG.