A TI{CRIMIC.TG4.0} DNA cassette has been inserted into Pka-R1, in a coding intron, and is predicted to gene trap a subset of the annotated transcripts of the gene. The insertion is in the coding intron of 15 transcript isoforms of Pka-R1 and is predicted to be a GAL4 reporter for them, but not for the other 3 isoforms in which the insertion is in an intron of the 5' UTR. The coding sequences of Pka-R1 downstream of the Trojan-Gal4 in all annotated transcripts are deleted. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Pka-R1 : one targeted to a coding intron (GACTGGTTTGACGTCACTATGGG) and the other to a non-coding exon in the 3' UTR (ATATCGGAGATAGCTTTCCCCGG). The PCR check of the insertion gave no band for the right flank and the expected sized product for the left flank. The insertion junction of the left flank was verified by sequencing.