ACTA

Mutations have been introduced into the core element of the predicted E2F motifs located upstream of the kdn gene. One of multiple regions of E2F motif mutations in kdn^DeltaE2F.

ATA

Mutations have been introduced into the core element of the predicted E2F motifs located upstream of the kdn gene. One of multiple regions of E2F motif mutations in kdn^DeltaE2F.

ATA

Mutations have been introduced into the core element of the predicted E2F motifs located upstream of the kdn gene. One of multiple regions of E2F motif mutations in kdn^DeltaE2F.

ATATCGTGCATACCCTTCCCTATGAAAATGCGATAGTA

Mutations have been introduced into the core element of the predicted E2F motifs located upstream of the kdn gene. One of multiple regions of E2F motif mutations in kdn^DeltaE2F.