A TI{KozakGAL4} DNA cassette has been inserted into Dbp45A, replacing the coding sequence (coordinates of deleted sequence are 2R:9087854..9089685 , release 6 genome). This results in a simultaneous knock-out of Dbp45A plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Dbp45A (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AACGTGCGCTGTATTAGTGATGG and GCTTGGTTGGGGTATCTTCTTGG. The 5' end of the deletion associated with the insertion is 46 bp from the 5' end of the CG13742 gene and may affect its expression. The 3' end of the deletion associated with the insertion is 89 bp downstream of the 3' end of the Nadk2 gene and may affect the proper 3' end formation of its transcripts.